ID: 1014441719

View in Genome Browser
Species Human (GRCh38)
Location 6:121480941-121480963
Sequence CTGCTAAGAAGCAGATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014441719_1014441727 -6 Left 1014441719 6:121480941-121480963 CCCCCAAATCTGCTTCTTAGCAG No data
Right 1014441727 6:121480958-121480980 TAGCAGGGGTCCTGTAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014441719 Original CRISPR CTGCTAAGAAGCAGATTTGG GGG (reversed) Intergenic
No off target data available for this crispr