ID: 1014442700

View in Genome Browser
Species Human (GRCh38)
Location 6:121491751-121491773
Sequence CATGGATTCAAGCATTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014442696_1014442700 10 Left 1014442696 6:121491718-121491740 CCTAAAGTGTTTAGGGTTGGGAT No data
Right 1014442700 6:121491751-121491773 CATGGATTCAAGCATTCCAAGGG No data
1014442695_1014442700 11 Left 1014442695 6:121491717-121491739 CCCTAAAGTGTTTAGGGTTGGGA No data
Right 1014442700 6:121491751-121491773 CATGGATTCAAGCATTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014442700 Original CRISPR CATGGATTCAAGCATTCCAA GGG Intergenic
No off target data available for this crispr