ID: 1014451358

View in Genome Browser
Species Human (GRCh38)
Location 6:121585494-121585516
Sequence CTGAAAATACAGAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46528
Summary {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014451353_1014451358 2 Left 1014451353 6:121585469-121585491 CCAACATGGAGAAACCCCGTCTC 0: 6845
1: 56626
2: 143579
3: 141534
4: 80613
Right 1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
1014451351_1014451358 11 Left 1014451351 6:121585460-121585482 CCAGCCTGACCAACATGGAGAAA 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
Right 1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
1014451352_1014451358 7 Left 1014451352 6:121585464-121585486 CCTGACCAACATGGAGAAACCCC 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
Right 1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG 0: 6
1: 418
2: 9235
3: 22516
4: 14353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014451358 Original CRISPR CTGAAAATACAGAATTAGCT GGG Intergenic
Too many off-targets to display for this crispr