ID: 1014451820

View in Genome Browser
Species Human (GRCh38)
Location 6:121590920-121590942
Sequence CTCAGTTCTTTATCCAATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014451820_1014451824 20 Left 1014451820 6:121590920-121590942 CCGGGATTGGATAAAGAACTGAG No data
Right 1014451824 6:121590963-121590985 GTATTTTCCACAGAGTAATCAGG No data
1014451820_1014451823 -9 Left 1014451820 6:121590920-121590942 CCGGGATTGGATAAAGAACTGAG No data
Right 1014451823 6:121590934-121590956 AGAACTGAGCGGAGGTTGTGAGG No data
1014451820_1014451827 30 Left 1014451820 6:121590920-121590942 CCGGGATTGGATAAAGAACTGAG No data
Right 1014451827 6:121590973-121590995 CAGAGTAATCAGGGAAATGCAGG No data
1014451820_1014451825 21 Left 1014451820 6:121590920-121590942 CCGGGATTGGATAAAGAACTGAG No data
Right 1014451825 6:121590964-121590986 TATTTTCCACAGAGTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014451820 Original CRISPR CTCAGTTCTTTATCCAATCC CGG (reversed) Intergenic
No off target data available for this crispr