ID: 1014451827

View in Genome Browser
Species Human (GRCh38)
Location 6:121590973-121590995
Sequence CAGAGTAATCAGGGAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014451820_1014451827 30 Left 1014451820 6:121590920-121590942 CCGGGATTGGATAAAGAACTGAG No data
Right 1014451827 6:121590973-121590995 CAGAGTAATCAGGGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014451827 Original CRISPR CAGAGTAATCAGGGAAATGC AGG Intergenic
No off target data available for this crispr