ID: 1014459323

View in Genome Browser
Species Human (GRCh38)
Location 6:121676774-121676796
Sequence AGCCCATTGCTGTGATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014459318_1014459323 -5 Left 1014459318 6:121676756-121676778 CCACTTTATGTCTGACCAAGCCC No data
Right 1014459323 6:121676774-121676796 AGCCCATTGCTGTGATGGAGGGG No data
1014459317_1014459323 -4 Left 1014459317 6:121676755-121676777 CCCACTTTATGTCTGACCAAGCC No data
Right 1014459323 6:121676774-121676796 AGCCCATTGCTGTGATGGAGGGG No data
1014459316_1014459323 15 Left 1014459316 6:121676736-121676758 CCTGCTCTTCTGACTAAATCCCA No data
Right 1014459323 6:121676774-121676796 AGCCCATTGCTGTGATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014459323 Original CRISPR AGCCCATTGCTGTGATGGAG GGG Intergenic
No off target data available for this crispr