ID: 1014461556

View in Genome Browser
Species Human (GRCh38)
Location 6:121702907-121702929
Sequence TCATGTCTTTTTAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014461556_1014461561 10 Left 1014461556 6:121702907-121702929 CCTTCCACCTTAAAAAGACATGA No data
Right 1014461561 6:121702940-121702962 CCATTCCAAGATGGCCAAATAGG 0: 54
1: 111
2: 339
3: 671
4: 1344
1014461556_1014461559 1 Left 1014461556 6:121702907-121702929 CCTTCCACCTTAAAAAGACATGA No data
Right 1014461559 6:121702931-121702953 GCTGAGATTCCATTCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014461556 Original CRISPR TCATGTCTTTTTAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr