ID: 1014463332

View in Genome Browser
Species Human (GRCh38)
Location 6:121725631-121725653
Sequence TTGTAGATTATTAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014463326_1014463332 30 Left 1014463326 6:121725578-121725600 CCTTCTAGCTTCCTACCAATAAC No data
Right 1014463332 6:121725631-121725653 TTGTAGATTATTAAGGAGGCAGG No data
1014463327_1014463332 19 Left 1014463327 6:121725589-121725611 CCTACCAATAACTAAAATTCAAT No data
Right 1014463332 6:121725631-121725653 TTGTAGATTATTAAGGAGGCAGG No data
1014463329_1014463332 -7 Left 1014463329 6:121725615-121725637 CCATAATTAAAAATTCTTGTAGA No data
Right 1014463332 6:121725631-121725653 TTGTAGATTATTAAGGAGGCAGG No data
1014463328_1014463332 15 Left 1014463328 6:121725593-121725615 CCAATAACTAAAATTCAATCTTC No data
Right 1014463332 6:121725631-121725653 TTGTAGATTATTAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014463332 Original CRISPR TTGTAGATTATTAAGGAGGC AGG Intergenic
No off target data available for this crispr