ID: 1014471705

View in Genome Browser
Species Human (GRCh38)
Location 6:121823351-121823373
Sequence GAGTTGTTTTCTTAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014471705_1014471708 -3 Left 1014471705 6:121823351-121823373 CCCAGCAGCTAAGAAAACAACTC No data
Right 1014471708 6:121823371-121823393 CTCTGTTATTTCTGAAGGCCTGG No data
1014471705_1014471713 26 Left 1014471705 6:121823351-121823373 CCCAGCAGCTAAGAAAACAACTC No data
Right 1014471713 6:121823400-121823422 CAGTGTCAGGTACCCCGGAGAGG No data
1014471705_1014471707 -8 Left 1014471705 6:121823351-121823373 CCCAGCAGCTAAGAAAACAACTC No data
Right 1014471707 6:121823366-121823388 AACAACTCTGTTATTTCTGAAGG No data
1014471705_1014471711 21 Left 1014471705 6:121823351-121823373 CCCAGCAGCTAAGAAAACAACTC No data
Right 1014471711 6:121823395-121823417 AAAGCCAGTGTCAGGTACCCCGG No data
1014471705_1014471709 13 Left 1014471705 6:121823351-121823373 CCCAGCAGCTAAGAAAACAACTC No data
Right 1014471709 6:121823387-121823409 GGCCTGGAAAAGCCAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014471705 Original CRISPR GAGTTGTTTTCTTAGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr