ID: 1014471761

View in Genome Browser
Species Human (GRCh38)
Location 6:121824022-121824044
Sequence GACCATTGATAAATGACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014471760_1014471761 -5 Left 1014471760 6:121824004-121824026 CCAAAATGTTATATTAATGACCA No data
Right 1014471761 6:121824022-121824044 GACCATTGATAAATGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014471761 Original CRISPR GACCATTGATAAATGACCCA TGG Intergenic
No off target data available for this crispr