ID: 1014476771

View in Genome Browser
Species Human (GRCh38)
Location 6:121882939-121882961
Sequence CACAAGGACATGCATAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014476767_1014476771 25 Left 1014476767 6:121882891-121882913 CCATTACTGAAGAGTTTTTAAGA No data
Right 1014476771 6:121882939-121882961 CACAAGGACATGCATAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014476771 Original CRISPR CACAAGGACATGCATAAACA TGG Intergenic
No off target data available for this crispr