ID: 1014479423

View in Genome Browser
Species Human (GRCh38)
Location 6:121917455-121917477
Sequence AAGGCCACCAGGTACTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014479418_1014479423 12 Left 1014479418 6:121917420-121917442 CCAAGTGCAAGAAGAGGCACCTT No data
Right 1014479423 6:121917455-121917477 AAGGCCACCAGGTACTCACTGGG No data
1014479420_1014479423 -7 Left 1014479420 6:121917439-121917461 CCTTGACATTGAACTGAAGGCCA No data
Right 1014479423 6:121917455-121917477 AAGGCCACCAGGTACTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014479423 Original CRISPR AAGGCCACCAGGTACTCACT GGG Intergenic
No off target data available for this crispr