ID: 1014479869

View in Genome Browser
Species Human (GRCh38)
Location 6:121922465-121922487
Sequence ACTCAAGCACAGAGGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014479864_1014479869 11 Left 1014479864 6:121922431-121922453 CCCAGGACAAAAAGGTCGGGGAG No data
Right 1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG No data
1014479865_1014479869 10 Left 1014479865 6:121922432-121922454 CCAGGACAAAAAGGTCGGGGAGG No data
Right 1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014479869 Original CRISPR ACTCAAGCACAGAGGGAGCT AGG Intergenic
No off target data available for this crispr