ID: 1014480363

View in Genome Browser
Species Human (GRCh38)
Location 6:121928372-121928394
Sequence GGGCTGATTAATGCTAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014480363_1014480370 26 Left 1014480363 6:121928372-121928394 CCACAATTAGCATTAATCAGCCC No data
Right 1014480370 6:121928421-121928443 CCAAAATTGTCCCTTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014480363 Original CRISPR GGGCTGATTAATGCTAATTG TGG (reversed) Intergenic
No off target data available for this crispr