ID: 1014484058

View in Genome Browser
Species Human (GRCh38)
Location 6:121977641-121977663
Sequence AAATTGCACCTGATCTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014484058_1014484062 4 Left 1014484058 6:121977641-121977663 CCATGATAGATCAGGTGCAATTT No data
Right 1014484062 6:121977668-121977690 AACCGGGGAAATCAGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014484058 Original CRISPR AAATTGCACCTGATCTATCA TGG (reversed) Intergenic
No off target data available for this crispr