ID: 1014486005

View in Genome Browser
Species Human (GRCh38)
Location 6:121999966-121999988
Sequence TGCCCACTAAAACCACAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014486005_1014486008 -9 Left 1014486005 6:121999966-121999988 CCCATTTGTGGTTTTAGTGGGCA No data
Right 1014486008 6:121999980-122000002 TAGTGGGCAGTGTGGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014486005 Original CRISPR TGCCCACTAAAACCACAAAT GGG (reversed) Intergenic
No off target data available for this crispr