ID: 1014490721

View in Genome Browser
Species Human (GRCh38)
Location 6:122058497-122058519
Sequence TTGAATTAGAATGAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014490719_1014490721 -4 Left 1014490719 6:122058478-122058500 CCAGGACTTGAATGTGAATTTGA No data
Right 1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG No data
1014490718_1014490721 -3 Left 1014490718 6:122058477-122058499 CCCAGGACTTGAATGTGAATTTG No data
Right 1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG No data
1014490717_1014490721 2 Left 1014490717 6:122058472-122058494 CCAAACCCAGGACTTGAATGTGA No data
Right 1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014490721 Original CRISPR TTGAATTAGAATGAGGAGAA AGG Intergenic
No off target data available for this crispr