ID: 1014499288

View in Genome Browser
Species Human (GRCh38)
Location 6:122165373-122165395
Sequence GGCCAACACAAGTTCCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014499288_1014499292 1 Left 1014499288 6:122165373-122165395 CCCACACGGAACTTGTGTTGGCC No data
Right 1014499292 6:122165397-122165419 GCAAGCACCGCATGCAGCCCTGG 0: 3
1: 45
2: 255
3: 434
4: 619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014499288 Original CRISPR GGCCAACACAAGTTCCGTGT GGG (reversed) Intergenic
No off target data available for this crispr