ID: 1014499845

View in Genome Browser
Species Human (GRCh38)
Location 6:122172813-122172835
Sequence ATTTTTGATGGTATTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014499845_1014499849 19 Left 1014499845 6:122172813-122172835 CCATCCACAATACCATCAAAAAT No data
Right 1014499849 6:122172855-122172877 AGGAATAAATTTGACAAAAGAGG No data
1014499845_1014499848 -1 Left 1014499845 6:122172813-122172835 CCATCCACAATACCATCAAAAAT No data
Right 1014499848 6:122172835-122172857 TAATAAAATAGAAAATACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014499845 Original CRISPR ATTTTTGATGGTATTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr