ID: 1014505057 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:122244974-122244996 |
| Sequence | CTGTAAACATAAATGTAAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014505054_1014505057 | 12 | Left | 1014505054 | 6:122244939-122244961 | CCTATCAATAATTATCTTGAGTG | 0: 2 1: 8 2: 64 3: 199 4: 500 |
||
| Right | 1014505057 | 6:122244974-122244996 | CTGTAAACATAAATGTAAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014505057 | Original CRISPR | CTGTAAACATAAATGTAAAT GGG | Intergenic | ||
| No off target data available for this crispr | |||||