ID: 1014505057

View in Genome Browser
Species Human (GRCh38)
Location 6:122244974-122244996
Sequence CTGTAAACATAAATGTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014505054_1014505057 12 Left 1014505054 6:122244939-122244961 CCTATCAATAATTATCTTGAGTG 0: 2
1: 8
2: 64
3: 199
4: 500
Right 1014505057 6:122244974-122244996 CTGTAAACATAAATGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014505057 Original CRISPR CTGTAAACATAAATGTAAAT GGG Intergenic
No off target data available for this crispr