ID: 1014505964

View in Genome Browser
Species Human (GRCh38)
Location 6:122256696-122256718
Sequence CGGGACAAAACACACTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014505964_1014505971 14 Left 1014505964 6:122256696-122256718 CCAACAAAGTGTGTTTTGTCCCG No data
Right 1014505971 6:122256733-122256755 GGGCAATACTATAGTACAGAAGG No data
1014505964_1014505968 -6 Left 1014505964 6:122256696-122256718 CCAACAAAGTGTGTTTTGTCCCG No data
Right 1014505968 6:122256713-122256735 GTCCCGGTTCATATAACTTGGGG No data
1014505964_1014505966 -8 Left 1014505964 6:122256696-122256718 CCAACAAAGTGTGTTTTGTCCCG No data
Right 1014505966 6:122256711-122256733 TTGTCCCGGTTCATATAACTTGG No data
1014505964_1014505967 -7 Left 1014505964 6:122256696-122256718 CCAACAAAGTGTGTTTTGTCCCG No data
Right 1014505967 6:122256712-122256734 TGTCCCGGTTCATATAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014505964 Original CRISPR CGGGACAAAACACACTTTGT TGG (reversed) Intergenic
No off target data available for this crispr