ID: 1014508845

View in Genome Browser
Species Human (GRCh38)
Location 6:122294992-122295014
Sequence CCTTATGACCTCACTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014508837_1014508845 18 Left 1014508837 6:122294951-122294973 CCAAGGGAATAGTGGACAACACA No data
Right 1014508845 6:122294992-122295014 CCTTATGACCTCACTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014508845 Original CRISPR CCTTATGACCTCACTGAGCA GGG Intergenic
No off target data available for this crispr