ID: 1014509239

View in Genome Browser
Species Human (GRCh38)
Location 6:122300644-122300666
Sequence AAACTGCAAGAGATTTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014509238_1014509239 -8 Left 1014509238 6:122300629-122300651 CCAAGATGGAGTTGGAAACTGCA No data
Right 1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG No data
1014509234_1014509239 9 Left 1014509234 6:122300612-122300634 CCTCCAAGAAGCAGATGCCAAGA 0: 5
1: 23
2: 64
3: 145
4: 447
Right 1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG No data
1014509233_1014509239 10 Left 1014509233 6:122300611-122300633 CCCTCCAAGAAGCAGATGCCAAG No data
Right 1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG No data
1014509235_1014509239 6 Left 1014509235 6:122300615-122300637 CCAAGAAGCAGATGCCAAGATGG No data
Right 1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014509239 Original CRISPR AAACTGCAAGAGATTTATTG AGG Intergenic
No off target data available for this crispr