ID: 1014519437

View in Genome Browser
Species Human (GRCh38)
Location 6:122422818-122422840
Sequence TCCCTAAGTTCAGGCAGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014519433_1014519437 19 Left 1014519433 6:122422776-122422798 CCTGTCATTCAGAGTGGAGAGCA 0: 1
1: 1
2: 3
3: 67
4: 779
Right 1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG 0: 2
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014519437 Original CRISPR TCCCTAAGTTCAGGCAGTGA TGG Exonic
900831063 1:4965648-4965670 TCCCTCAGCTCAGGCACAGAGGG + Intergenic
901646826 1:10721271-10721293 TCCCTAAGATCAGGGGGTGGGGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902758775 1:18567158-18567180 TCCCTAAGTCCTGGCAGGCAAGG - Intergenic
903122803 1:21227299-21227321 TCTCTAAGCCCAGGAAGTGAGGG - Intronic
903728104 1:25467282-25467304 TCTCTAAGATCAGGCAGAGCAGG + Intronic
904313063 1:29641819-29641841 TCCCTAGGTGCAGGCAGAGTGGG - Intergenic
904886119 1:33739732-33739754 TCCCTAACTTCAGACAGTTATGG + Intronic
905684386 1:39898418-39898440 TCCCCAAGTGCAGGCTGTGCTGG - Intronic
908116418 1:60944833-60944855 TGCCTAAATTCTGGCTGTGAAGG - Intronic
911041153 1:93592041-93592063 TCCACATGTTCAGGAAGTGAAGG - Intronic
911521671 1:98937144-98937166 TGCCCAGGTGCAGGCAGTGAGGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912203105 1:107480633-107480655 TCCCTCCGTTCTGGCAGTGCAGG - Exonic
914957939 1:152181553-152181575 TCCCTAGGTTCAGCCAGTTCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915894211 1:159798832-159798854 TCCATGAGTTCAGGAATTGACGG - Intergenic
918253837 1:182730006-182730028 TCCCTAACTTCAGGCATATAAGG + Intergenic
920019775 1:202946656-202946678 TCCCCAAGGACAAGCAGTGATGG + Intronic
921685148 1:218081636-218081658 TCCTTAACTTCAGGAAGTGAAGG + Intergenic
922015205 1:221638093-221638115 TCCCTATCTTCAGGCAGAGGAGG - Intergenic
922633211 1:227135459-227135481 TCCCATAGTTTAGGAAGTGAAGG + Intronic
924150317 1:241123325-241123347 TGCCTTAGTTCAGGCAGTTATGG + Intronic
1068189091 10:53626958-53626980 TCCCAAAGTGCAGGAATTGAGGG + Intergenic
1068272299 10:54744230-54744252 TCCCAAGGTTCAACCAGTGATGG - Intronic
1071239456 10:83688555-83688577 TCCCAAAGTTCAGGGATTAAAGG - Intergenic
1073840619 10:107495144-107495166 TCCCAAAGTTCAGGGATTAAAGG - Intergenic
1074591061 10:114813638-114813660 TCCCAAAGTGCAGGGATTGAAGG - Intergenic
1074730273 10:116365045-116365067 GCCCTTAGTTCAGTGAGTGAGGG + Intronic
1074995172 10:118750606-118750628 TCCCTCAGCTATGGCAGTGAAGG - Intronic
1080726639 11:34904704-34904726 TCCCTAAGCCCAGGCTGGGAAGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081099325 11:38982617-38982639 CACCTCAGCTCAGGCAGTGAAGG - Intergenic
1082836534 11:57654940-57654962 TCCCTAAGTTCAGCTTGAGATGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1087883101 11:103442383-103442405 ACCCTAAGTTCATACTGTGATGG - Intronic
1092025596 12:5236989-5237011 TGCCTAAGGTAAGGCAGTCATGG - Intergenic
1094545393 12:31399757-31399779 TCCCCAAGTTCTGGCACTGTAGG + Exonic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096573973 12:52541138-52541160 TCCTCAAGTGCAGACAGTGAAGG - Intergenic
1096589926 12:52651362-52651384 TTCCTAAGTGCAGGCTGTTATGG + Intronic
1096924106 12:55123110-55123132 TCCCTAAGTTCAGGCAGTGATGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099286458 12:80718223-80718245 TTCCTAAATCAAGGCAGTGAAGG + Intronic
1099524659 12:83704985-83705007 TCCCCAACTCCAGGCAGTGGAGG + Intergenic
1102993546 12:117331352-117331374 TCCCTAAGGTCAGGCAGAAAGGG + Exonic
1103548574 12:121719500-121719522 TACCTAAGTTCAGGAAGTGGAGG + Intronic
1106032241 13:26013734-26013756 TCACACAGTACAGGCAGTGAAGG + Intronic
1106103494 13:26714358-26714380 TCCCTAAGGTTGGGGAGTGAGGG + Intergenic
1107505093 13:41025980-41026002 TCCCTGAGTTAGGACAGTGAAGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109888978 13:68582185-68582207 CCTCTACCTTCAGGCAGTGAAGG - Intergenic
1110267046 13:73550496-73550518 TCCCAAAGTGCTGGCAGTGCTGG + Intergenic
1113275526 13:108725184-108725206 TCCCTATGTTCAGAAAGTGAGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120615463 14:86698557-86698579 TCGAGAAGTTCAGGCATTGAGGG + Intergenic
1120888597 14:89471738-89471760 CCCCTAACTTCAGGCAGGCAGGG - Intronic
1125334519 15:38614389-38614411 TCCTTTAGATCTGGCAGTGAAGG + Intergenic
1125480900 15:40079624-40079646 TCCCTGGCCTCAGGCAGTGATGG + Intergenic
1126602174 15:50439994-50440016 TCCCTGAGTCCAGGAAGTGGAGG + Intronic
1128226427 15:66004592-66004614 TCCGTAAGTGCAGGAAGTCAGGG - Intronic
1128309265 15:66620380-66620402 TCCCTCAGTTCAGGATGTGGGGG + Intronic
1133143528 16:3766252-3766274 TACCAAAATTCAGCCAGTGAAGG - Intronic
1137317538 16:47342429-47342451 CCCCTAAGTTCAGGAAGTTAAGG + Intronic
1138404786 16:56782074-56782096 TCCCTCAATTCAGGCAGTTTGGG + Intronic
1141386392 16:83625744-83625766 TCCCTAATTTCAGGGGGTGGGGG - Intronic
1144998969 17:19290220-19290242 TGCCTAAGATCACGCAGAGATGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1148116224 17:45176793-45176815 TCCCAAAGTTAAGGGAGGGAGGG - Intergenic
1150467611 17:65407295-65407317 TTCCTAAGTTCAGGCTTTGCAGG - Intergenic
1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG + Intronic
1154988157 18:21573978-21574000 TCACTTTGTTCAGGCACTGATGG + Exonic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156845543 18:41661751-41661773 TTACTAAGTTCAGCCATTGATGG + Intergenic
1157975208 18:52319349-52319371 TTCCTGAGTTCAGGCAAGGAGGG + Intergenic
1158546198 18:58399411-58399433 TCCCTAAATTCAGACAATGAGGG + Intronic
1160309763 18:77778471-77778493 GCCCGAAGTGCAGGCAGTGGAGG + Intergenic
1161937328 19:7380092-7380114 TGGCTGAGTCCAGGCAGTGAAGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG + Intronic
926144839 2:10390725-10390747 TCCCAAAGACCAGCCAGTGAGGG + Intronic
926432446 2:12802102-12802124 CCCCTAATTTTAGGCAGTCAGGG + Intergenic
927573726 2:24182869-24182891 TCCCTCAGTTCAGCCATTTAAGG + Intronic
930063970 2:47313498-47313520 TGTCTCAGTTCAGGCATTGAGGG - Intergenic
931152849 2:59594500-59594522 TAACTATGTTCAGGCAGAGAGGG - Intergenic
931282589 2:60807375-60807397 TCCCTAAGCACAGGAAGTGAAGG + Intergenic
932101200 2:68900736-68900758 CCCCTAACTCCAGGCAGTGGAGG + Intergenic
932357626 2:71079296-71079318 TACCATAGTTCAGCCAGTGAAGG + Intronic
932370084 2:71179548-71179570 TACCATAGTTCAGCCAGTGAAGG + Intergenic
934774634 2:96929275-96929297 TCCCTGACTTCTTGCAGTGAGGG + Exonic
937607181 2:123815156-123815178 TCCCAAAGTTCTGGGAGTGCTGG - Intergenic
938373824 2:130791204-130791226 TACCTAAGTACAGGCAGAGGTGG - Intergenic
940385711 2:153068979-153069001 TCTCTCTGTTCAGCCAGTGAAGG + Intergenic
944625884 2:201568377-201568399 CCCCTAAGTTAGGACAGTGAAGG + Intronic
947267869 2:228302747-228302769 TCCCTAAGCTCAAGCTGGGAAGG - Intergenic
947990919 2:234486921-234486943 GCCCTGAGTTCAGGCAGTCCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948958153 2:241310854-241310876 TCCCGAAGTGCTGGGAGTGAAGG - Intronic
1169114140 20:3052013-3052035 TCCCTAAGTTCTGGGATTAAAGG - Intergenic
1169537893 20:6565575-6565597 TCCCTAGGTACAGGCAGCAAGGG + Intergenic
1174950302 20:55035205-55035227 TCTCTTAGTTTAGGCAGAGAGGG + Intergenic
1177640601 21:23839924-23839946 TCCCTAATTTTAGTCAGTCAGGG - Intergenic
1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG + Intergenic
1183379188 22:37482324-37482346 TCCCTAAGTGTGGCCAGTGAGGG + Intronic
1184461555 22:44640649-44640671 TCCCTGGGCTCTGGCAGTGATGG - Intergenic
1185230248 22:49676396-49676418 GCCCTAAGATGAGGCTGTGAAGG + Intergenic
952911101 3:38187351-38187373 ACTCTAAATTCAGGCAGTGATGG + Intronic
953924034 3:46971814-46971836 TCTCCAAGTGCAGGCAGAGAAGG + Intronic
954905931 3:54062790-54062812 TTCCTGAGGTTAGGCAGTGAGGG + Intergenic
955530987 3:59873005-59873027 TGACTCAGTTCAGGCTGTGAAGG - Intronic
956796648 3:72724153-72724175 TCCCAAAGTGCTGGCATTGAAGG + Intergenic
959948296 3:112150112-112150134 TCCCACAATTCTGGCAGTGAAGG + Intronic
960238030 3:115307175-115307197 TTCCTTGGTTCAGGCATTGAGGG - Intergenic
961335912 3:126179769-126179791 TCCCAAAGTGCAGACAGAGACGG - Intronic
962310324 3:134321841-134321863 TCCCAAAGTGCAGGCATTGCAGG + Intergenic
964506731 3:157407697-157407719 TCCCTAATTTCAGTCTGTTAGGG + Intronic
965643097 3:170852280-170852302 TCCTTGAGTCCAGGAAGTGAAGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
968685534 4:1955736-1955758 TCTCGATGTTCAGGCAGTCAGGG - Exonic
970103173 4:12548462-12548484 TCCTTAAAATCAGGCATTGAGGG + Intergenic
971028203 4:22608957-22608979 ACCCAAAGTCCAGGCAGTGCTGG - Intergenic
972560565 4:40224502-40224524 CCCCTAAGTACAGGAAGTAAGGG + Intronic
974267812 4:59608027-59608049 TCAGAAGGTTCAGGCAGTGAGGG + Intergenic
975629407 4:76385092-76385114 TTTCTAAGATCAGGCACTGAGGG + Intronic
976118959 4:81759302-81759324 TCCCTAGGATAAGGCAGGGAGGG - Intronic
977644938 4:99401878-99401900 TCCCTAAAGTCATGGAGTGAGGG - Intergenic
977727744 4:100316898-100316920 TCCCTAAGCTCCTGCAGTAAAGG + Intergenic
978373235 4:108050304-108050326 ACCCTTAGGTAAGGCAGTGAAGG + Intronic
978373345 4:108050953-108050975 ACCCTTAGGTAAGGCAGTGAAGG - Intronic
979257021 4:118616831-118616853 TCCCTAAGTTCTGGAATTGCAGG + Intergenic
979331328 4:119423715-119423737 TCCCTAAGTTCTGGAATTGCAGG - Intergenic
980449627 4:132953766-132953788 TACCTAAGTGGATGCAGTGACGG + Intergenic
983412886 4:167421308-167421330 TCCCTAAGCTCAAGCTGGGAAGG + Intergenic
983487897 4:168353317-168353339 TCACTTAATTCAGGCAGTGTAGG + Intergenic
984386475 4:179066448-179066470 TCCCAAAGTTCTGGCATTGCAGG - Intergenic
985631220 5:1015058-1015080 TCCATAAGGCCAGGCAGCGAGGG + Intronic
986051215 5:4092003-4092025 ACCCTGATCTCAGGCAGTGAAGG - Intergenic
991553717 5:67871969-67871991 TCCATAAGCTCAGGCAATAATGG - Intergenic
993211104 5:84952264-84952286 TAAATAAGTTCAGGCAGTGTTGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
998530223 5:142877458-142877480 TCCCCAACATCAGGCAGTGTTGG + Intronic
1002691797 5:181055081-181055103 CGCCTAAGTGCAGGCACTGAGGG - Intronic
1003075243 6:2977947-2977969 TTCCAAAGTTCAGGCCATGATGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006221075 6:32492380-32492402 TCCCTAATTTTAGCCAGTCAGGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1013454267 6:110315986-110316008 TCCCTTATTTCAGGCAGATAAGG + Intronic
1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG + Exonic
1015868962 6:137756245-137756267 TCCCAAAGTTCTGGGATTGAAGG - Intergenic
1020755693 7:12200150-12200172 TGCCTAGGGTCAGGCAGTGAAGG + Intergenic
1024582123 7:50808849-50808871 CCCCTAAATTCAGGCTGTTAGGG - Intergenic
1030123890 7:106136607-106136629 TGCCTAAGTTCACGGAGAGAGGG + Intergenic
1030367582 7:108663112-108663134 TCCATAATTTAAAGCAGTGAAGG - Intergenic
1030631326 7:111899225-111899247 ACCCAAGGTTCAGGCAGAGAAGG - Intronic
1037650147 8:20829069-20829091 TACCTAAATTCAGGCAGGTATGG + Intergenic
1037724957 8:21475368-21475390 TTCCTAAGGTCAAGCAGTTAGGG + Intergenic
1038384277 8:27127229-27127251 TTTCTAAATTCAGGCAGAGATGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040607566 8:48949631-48949653 TCCCTAGGTTCAGGTAGAGCTGG - Intergenic
1040730318 8:50438107-50438129 TCCCGAATTCCAGGCAGGGATGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043614823 8:82112949-82112971 TCCCTAATTTTAGTCAGTCAGGG - Intergenic
1044276302 8:90303325-90303347 TCCCTAGGTTCAGGCACACAAGG + Intergenic
1044928725 8:97231810-97231832 TCCCTAAATTCAGTGGGTGAAGG - Intergenic
1045012531 8:97970639-97970661 TCCCTAATTTTAGTCAGTCAGGG - Intronic
1048621291 8:136135413-136135435 TCCCTAGGTTTAGTCAGTCAGGG + Intergenic
1048943083 8:139419390-139419412 TCCCAAACTTCAGGCAGATAAGG + Intergenic
1057825287 9:98368466-98368488 TCCCCTAGCTCAGGCAGTGCAGG + Intronic
1061833146 9:133309264-133309286 TCCCAAAGTGCAGGCATTGCGGG + Intergenic
1061971903 9:134049617-134049639 CCCATAAGTGCAGGCAGTGAAGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186056559 X:5655323-5655345 CCCCTAAGTTGAGTCAGTTAGGG - Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187890604 X:23930850-23930872 TCCGTAAGTTCTGGCATTGCAGG + Intronic
1189280221 X:39815996-39816018 TCCCTCAGTCCAGGGAGTGGTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193909559 X:87285730-87285752 TCCCTAAATTCAGGCACTGCTGG + Intergenic
1195012060 X:100742352-100742374 GGCCTGAGTTAAGGCAGTGACGG - Intergenic
1196549346 X:117003832-117003854 TCAATAATTTCAGGCAATGATGG + Intergenic
1197787740 X:130216738-130216760 TCCCAAAGTTCAGGGAGTACAGG - Intronic
1198572222 X:137970237-137970259 ACCCAAAGTTCATGCACTGATGG + Intergenic
1199580287 X:149353540-149353562 TCCCTGAGGTAAGACAGTGAAGG - Intergenic
1199793287 X:151174744-151174766 TCCGTAAGTGCAGACAGTGAAGG - Intergenic
1200132247 X:153856947-153856969 TCCCAAAGTGCAGGCACTGCAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201532663 Y:15009462-15009484 TCCCAAAATTCATACAGTGAAGG + Intergenic
1201729941 Y:17192515-17192537 TGCCTCTGCTCAGGCAGTGAGGG - Intergenic