ID: 1014523981

View in Genome Browser
Species Human (GRCh38)
Location 6:122479044-122479066
Sequence AAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2291
Summary {0: 3, 1: 77, 2: 306, 3: 637, 4: 1268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014523981_1014523989 22 Left 1014523981 6:122479044-122479066 CCACCCTGCTTCTGCTTGCCCTT 0: 3
1: 77
2: 306
3: 637
4: 1268
Right 1014523989 6:122479089-122479111 TCAGTCCCGATGAGATGAGCTGG No data
1014523981_1014523990 23 Left 1014523981 6:122479044-122479066 CCACCCTGCTTCTGCTTGCCCTT 0: 3
1: 77
2: 306
3: 637
4: 1268
Right 1014523990 6:122479090-122479112 CAGTCCCGATGAGATGAGCTGGG 0: 1
1: 80
2: 381
3: 913
4: 1000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014523981 Original CRISPR AAGGGCAAGCAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr