ID: 1014523981 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:122479044-122479066 |
| Sequence | AAGGGCAAGCAGAAGCAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2291 | |||
| Summary | {0: 3, 1: 77, 2: 306, 3: 637, 4: 1268} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014523981_1014523989 | 22 | Left | 1014523981 | 6:122479044-122479066 | CCACCCTGCTTCTGCTTGCCCTT | 0: 3 1: 77 2: 306 3: 637 4: 1268 |
||
| Right | 1014523989 | 6:122479089-122479111 | TCAGTCCCGATGAGATGAGCTGG | No data | ||||
| 1014523981_1014523990 | 23 | Left | 1014523981 | 6:122479044-122479066 | CCACCCTGCTTCTGCTTGCCCTT | 0: 3 1: 77 2: 306 3: 637 4: 1268 |
||
| Right | 1014523990 | 6:122479090-122479112 | CAGTCCCGATGAGATGAGCTGGG | 0: 1 1: 80 2: 381 3: 913 4: 1000 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014523981 | Original CRISPR | AAGGGCAAGCAGAAGCAGGG TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||