ID: 1014526204

View in Genome Browser
Species Human (GRCh38)
Location 6:122504854-122504876
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 3, 1: 16, 2: 23, 3: 18, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014526204_1014526213 4 Left 1014526204 6:122504854-122504876 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 1014526213 6:122504881-122504903 CCGAAGTCCGGTGGTAACAAAGG 0: 1
1: 2
2: 13
3: 18
4: 53
1014526204_1014526209 -8 Left 1014526204 6:122504854-122504876 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 1
2: 7
3: 14
4: 30
1014526204_1014526211 -5 Left 1014526204 6:122504854-122504876 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 1014526211 6:122504872-122504894 GTAGGGTATCCGAAGTCCGGTGG 0: 2
1: 3
2: 19
3: 23
4: 22
1014526204_1014526215 20 Left 1014526204 6:122504854-122504876 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 1014526215 6:122504897-122504919 ACAAAGGAATGAGAAGAGACAGG 0: 23
1: 18
2: 19
3: 67
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014526204 Original CRISPR CCTACGGATGGTGTTGAGGC TGG (reversed) Intronic
901689353 1:10962564-10962586 CCTACAGAGGGAGCTGAGGCTGG - Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
904544714 1:31260242-31260264 CCTGTGGATGGTGTTTAGGAGGG - Intronic
914765797 1:150636632-150636654 CCATCAGATGGTGTTGAGGAGGG + Intergenic
914862437 1:151397868-151397890 CCTAAGGACAGTGTTGAGGATGG + Intergenic
914876529 1:151516471-151516493 CCTATGGATGGTGTTGGCTCTGG + Intronic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
922057242 1:222052939-222052961 CCATCTGAGGGTGTTGAGGCAGG + Intergenic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1072429184 10:95356057-95356079 CTTCCGGATGGTGGTGAAGCGGG + Intronic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1083949815 11:65947715-65947737 CCTTCGGAGGTTGTTGAAGCTGG - Exonic
1086101682 11:83106825-83106847 CCTACTGATGGTGATGTGTCTGG - Intergenic
1086151633 11:83617714-83617736 ACTAAGTATGGTGTTTAGGCTGG + Intronic
1089596967 11:119586490-119586512 CCTGGGGATGGTGGTGAGTCAGG - Intergenic
1091970281 12:4780852-4780874 CCTAAGGATGGAGTGGAGACAGG - Intronic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1096974389 12:55691296-55691318 CCTAGGGCTGGAGTGGAGGCGGG + Intronic
1098198068 12:68023480-68023502 CTTAGGGAAGATGTTGAGGCTGG - Intergenic
1100424497 12:94471354-94471376 GCTACGGGGGGTGCTGAGGCAGG - Intergenic
1104410303 12:128552054-128552076 CCTAAGGCTGTTGATGAGGCGGG + Intronic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1106505832 13:30369794-30369816 GCTACTGATGATGCTGAGGCCGG + Intergenic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1107624348 13:42267717-42267739 CCTGTGGAAGGTGATGAGGCAGG + Intergenic
1109368188 13:61385453-61385475 CCTAAGGAAGGTATTGCGGCAGG + Intergenic
1115054658 14:29108684-29108706 ACTAAGGTGGGTGTTGAGGCTGG + Intergenic
1120016144 14:79476008-79476030 CCAACTGATGGTGTTAAGGGAGG - Intronic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1122809476 14:104280933-104280955 ACCAGGGATGGTGTGGAGGCTGG + Intergenic
1125139870 15:36393062-36393084 CACACGGATTGTGTTGGGGCAGG + Intergenic
1125638138 15:41206731-41206753 GCTACTAATGGTGCTGAGGCAGG - Intronic
1128073632 15:64812590-64812612 CCTATGGATGGTGATCAGGGCGG + Intergenic
1128114711 15:65097935-65097957 CCTTCTGATGGTGGTGGGGCAGG + Intronic
1129487681 15:75891700-75891722 CATAAGGATGTTGTTCAGGCTGG + Intronic
1131010547 15:89014292-89014314 GACAGGGATGGTGTTGAGGCTGG - Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1140453921 16:75093689-75093711 CCGACGGATGCTCTGGAGGCTGG - Intronic
1142676795 17:1518459-1518481 CCCACGGATGGTGTTGCTGCTGG - Exonic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1145010182 17:19363586-19363608 CCAACAGATGCTGTTGGGGCTGG - Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1150449095 17:65250886-65250908 CCCAAGGATGGTCTTGAGGGTGG + Intergenic
1151803295 17:76390410-76390432 CCAAGGGATAGTGTTGACGCTGG + Exonic
1159904650 18:74078436-74078458 GCTGCGGCTGGTGCTGAGGCGGG - Intronic
1160227849 18:77025136-77025158 CATACGGAGGGAGTTTAGGCAGG - Intronic
1160715783 19:575980-576002 CCTCCGGATGCTGATGATGCTGG - Intronic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1162557007 19:11393362-11393384 CCTAAGAAAGGTGTTGAGTCGGG - Intronic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
933725604 2:85425372-85425394 CCTCAGGAGGTTGTTGAGGCAGG - Intronic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
937102124 2:119279831-119279853 CCTACGGATGGGGGTGGTGCTGG - Intergenic
937983833 2:127629777-127629799 CGTGGGGATGGTGTAGAGGCAGG - Exonic
939638628 2:144612563-144612585 CTTGGGGATGGAGTTGAGGCTGG + Intergenic
944181083 2:196894942-196894964 CCTAAGCATGGTGATAAGGCAGG - Intronic
944731614 2:202523229-202523251 ACAACGGATGCTGTTGAGACTGG + Intronic
948422778 2:237870765-237870787 CCTAAGGTTGGAGGTGAGGCTGG + Intronic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
1171161304 20:22926320-22926342 CCAATGGAAGGTGTTGAGTCAGG - Intergenic
1171524661 20:25799434-25799456 CCTGGGGATGGGGTTGCGGCTGG - Intronic
1171552166 20:26056449-26056471 CCTGGGGATGGGGTTGCGGCTGG + Intergenic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1181710845 22:24687085-24687107 CTTATGGTTGGTGATGAGGCAGG + Intergenic
1183565210 22:38609579-38609601 CAAACGGTTGTTGTTGAGGCTGG - Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
949412217 3:3778378-3778400 CCTAGGGATGGTGTTGATGATGG - Intronic
950831648 3:15880149-15880171 CCTGGGGATGGTGGTGAGTCAGG - Intergenic
954446655 3:50550420-50550442 CCTTTGGAGGGTGTGGAGGCGGG + Intergenic
955865988 3:63384858-63384880 CATAGCCATGGTGTTGAGGCTGG + Intronic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
965765708 3:172128089-172128111 CCTACGGGTTGTGTTGAGCAAGG + Intronic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
973313033 4:48729714-48729736 CCTACGGATGGGGTTTTGGTGGG - Intronic
973620681 4:52722505-52722527 CCTAGGGGTGGGCTTGAGGCCGG - Intergenic
973914025 4:55614958-55614980 CCTACGGAATGGGTTGAGGCAGG + Intronic
976148592 4:82069036-82069058 CCTAGGAATGGTTTTGATGCTGG - Intergenic
981196713 4:141929489-141929511 GCTACTGAGGCTGTTGAGGCTGG + Intergenic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
984432118 4:179663073-179663095 CTTACGGATGGTGTTAAGTGAGG - Intergenic
986859291 5:11906462-11906484 CCTACAGATACTGTTGGGGCTGG + Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
995910055 5:117176293-117176315 GCCACAGCTGGTGTTGAGGCAGG + Intergenic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1001438911 5:171723213-171723235 CCTCCCGAGGGTGCTGAGGCAGG - Intergenic
1001490568 5:172151882-172151904 CCCACAGAAGGTGTTGCGGCTGG - Intronic
1003624521 6:7728962-7728984 CCAAGGGAGGGTGTGGAGGCAGG + Intronic
1004171228 6:13297004-13297026 CCTAGGCATGATGCTGAGGCCGG - Intronic
1004646568 6:17567908-17567930 GCTACTGATGAGGTTGAGGCAGG + Intergenic
1004731722 6:18366131-18366153 CCTGCGGATGATGGTGAGTCAGG + Intergenic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1006947467 6:37794404-37794426 CCTACTCAGGGGGTTGAGGCAGG + Intergenic
1007226447 6:40318616-40318638 CCTACTGATGGTGCTGTGCCAGG - Intergenic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1014588355 6:123229795-123229817 CCTACCATTGGTGCTGAGGCTGG - Intronic
1027210181 7:76140834-76140856 ACTACTGATGGTTTTGAAGCTGG + Intergenic
1034826123 7:154264778-154264800 CCTGATGATGGTGTTGATGCTGG + Intronic
1036816069 8:11903676-11903698 ACCACGGATGGTGTGGAGGTGGG - Intergenic
1037140909 8:15519669-15519691 CCCACGGATGGTGGGGATGCAGG - Intronic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1040333250 8:46403109-46403131 ACTAAGGGTGATGTTGAGGCAGG + Intergenic
1040333460 8:46404181-46404203 CCTCAGGAGGATGTTGAGGCAGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1045750385 8:105476830-105476852 ACTAGGGATGGTGTTGGGGGTGG + Intronic
1047684765 8:127293734-127293756 CCTACTGATGTTGGTGAGGTTGG + Intergenic
1049378417 8:142300476-142300498 CCTGCAGATGGAGGTGAGGCTGG - Exonic
1051152681 9:14100596-14100618 GCTACGGAGGGGGCTGAGGCAGG + Intronic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1053793001 9:41699926-41699948 CCTGGGGATGGGGTTGGGGCCGG - Intergenic
1054152174 9:61614898-61614920 CCTGGGGATGGGGTTGGGGCCGG + Intergenic
1054181410 9:61911947-61911969 CCTGGGGATGGGGTTGGGGCCGG - Intergenic
1054471948 9:65546042-65546064 CCTGGGGATGGGGTTGGGGCCGG + Intergenic
1055391503 9:75826768-75826790 GCTACTGATGCTGCTGAGGCAGG - Intergenic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1061926210 9:133807290-133807312 CCTGCGGCTGGTGCTGAGCCCGG - Exonic
1062161959 9:135085573-135085595 CATACGGATGCTGATGGGGCAGG - Intronic
1185860053 X:3569381-3569403 CCTTGGGAGGGGGTTGAGGCAGG - Intergenic
1190554128 X:51616661-51616683 CCTAGGGATTGAGTTGAGGTAGG - Intergenic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1195807044 X:108785737-108785759 CCTACGGTTGGTGGGAAGGCAGG - Intergenic
1196755192 X:119151258-119151280 TCTAAGGATGCTGTTGTGGCGGG - Intergenic
1197442846 X:126511979-126512001 CTTACACATGGTGTTGAGCCTGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic