ID: 1014526209

View in Genome Browser
Species Human (GRCh38)
Location 6:122504869-122504891
Sequence TCCGTAGGGTATCCGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 7, 3: 14, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014526203_1014526209 3 Left 1014526203 6:122504843-122504865 CCTGTTGTGGGCCAGCCTCAACA 0: 1
1: 0
2: 2
3: 7
4: 103
Right 1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 1
2: 7
3: 14
4: 30
1014526204_1014526209 -8 Left 1014526204 6:122504854-122504876 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 1
2: 7
3: 14
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014526209 Original CRISPR TCCGTAGGGTATCCGAAGTC CGG Intronic
900558767 1:3293204-3293226 TCTGTAGAGGATCCTAAGTCGGG + Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
910769752 1:90818885-90818907 GGAGTAGGGTATCCCAAGTCAGG + Intergenic
915271638 1:154757829-154757851 TCCCTTGAGTATCCAAAGTCAGG - Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1075012984 10:118890824-118890846 TCTCTAGGGTACCCGAAGTGAGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1100279468 12:93104546-93104568 TCCCTAGTGAATCTGAAGTCAGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1135123145 16:19784102-19784124 TCCGCAGGGAATCCTATGTCAGG - Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1150243807 17:63658434-63658456 TCTGTAGGGTGTCAGAAGTGGGG + Intronic
1150952437 17:69818775-69818797 TCGGTAAGGTATCTGGAGTCAGG - Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
1178779348 21:35586837-35586859 TCCCTGGAGTATCTGAAGTCAGG - Intronic
1179783771 21:43718679-43718701 TCCCTTGGGTATCCGGGGTCCGG + Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
954129328 3:48552077-48552099 TCCGCAGGGGATCAGGAGTCAGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
966446140 3:180003122-180003144 TCAATAGGGTATTTGAAGTCAGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1007451482 6:41942821-41942843 TCCTTAGTGTCTCCTAAGTCAGG - Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1027411371 7:77922613-77922635 TCCTTTGGGTATCCTAAGTTGGG - Exonic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1062038736 9:134394602-134394624 TCCGCAGGGGATCCAAAGGCAGG - Intronic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic