ID: 1014526209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:122504869-122504891 |
| Sequence | TCCGTAGGGTATCCGAAGTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 53 | |||
| Summary | {0: 1, 1: 1, 2: 7, 3: 14, 4: 30} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014526203_1014526209 | 3 | Left | 1014526203 | 6:122504843-122504865 | CCTGTTGTGGGCCAGCCTCAACA | 0: 1 1: 0 2: 2 3: 7 4: 103 |
||
| Right | 1014526209 | 6:122504869-122504891 | TCCGTAGGGTATCCGAAGTCCGG | 0: 1 1: 1 2: 7 3: 14 4: 30 |
||||
| 1014526204_1014526209 | -8 | Left | 1014526204 | 6:122504854-122504876 | CCAGCCTCAACACCATCCGTAGG | 0: 3 1: 16 2: 23 3: 18 4: 96 |
||
| Right | 1014526209 | 6:122504869-122504891 | TCCGTAGGGTATCCGAAGTCCGG | 0: 1 1: 1 2: 7 3: 14 4: 30 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014526209 | Original CRISPR | TCCGTAGGGTATCCGAAGTC CGG | Intronic | ||