ID: 1014526209

View in Genome Browser
Species Human (GRCh38)
Location 6:122504869-122504891
Sequence TCCGTAGGGTATCCGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 7, 3: 14, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014526203_1014526209 3 Left 1014526203 6:122504843-122504865 CCTGTTGTGGGCCAGCCTCAACA 0: 1
1: 0
2: 2
3: 7
4: 103
Right 1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 1
2: 7
3: 14
4: 30
1014526204_1014526209 -8 Left 1014526204 6:122504854-122504876 CCAGCCTCAACACCATCCGTAGG 0: 3
1: 16
2: 23
3: 18
4: 96
Right 1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG 0: 1
1: 1
2: 7
3: 14
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014526209 Original CRISPR TCCGTAGGGTATCCGAAGTC CGG Intronic