ID: 1014538833

View in Genome Browser
Species Human (GRCh38)
Location 6:122649790-122649812
Sequence AGCTGTCTTCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 1, 2: 10, 3: 234, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014538830_1014538833 16 Left 1014538830 6:122649751-122649773 CCCAGTAGCAGGCAAAAAGCTGT 0: 1
1: 3
2: 44
3: 271
4: 396
Right 1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG 0: 1
1: 1
2: 10
3: 234
4: 385
1014538831_1014538833 15 Left 1014538831 6:122649752-122649774 CCAGTAGCAGGCAAAAAGCTGTT 0: 1
1: 3
2: 16
3: 86
4: 383
Right 1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG 0: 1
1: 1
2: 10
3: 234
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014538833 Original CRISPR AGCTGTCTTCAGAAGATGGC AGG Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907592696 1:55690946-55690968 TAATGTCTTCAGGAGATGGCTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907601956 1:55780910-55780932 AGCTGGCTTCACAGGATGGTGGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910147852 1:84103509-84103531 ATCTGTCTTCAGCTGAAGGCTGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910677085 1:89825754-89825776 AGATGTCTTCTGAAGCTGGCAGG + Intronic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919839256 1:201597398-201597420 AGCTGTCTTCAGAGTGAGGCCGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924494664 1:244575470-244575492 AGCTGTCCTCCGAGGGTGGCAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065866644 10:29920435-29920457 ACCTGTTTTGAGAAGATGGTAGG + Intergenic
1066644299 10:37589817-37589839 AGCTCTCTTCATAAGATATCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067261982 10:44700697-44700719 AGCTGTCTTCAGAAAAATGGTGG - Intergenic
1067822682 10:49543762-49543784 AGCTGTATTCCCAAGAGGGCAGG - Intergenic
1067844457 10:49708884-49708906 AGTTCACTTCAGAAGATGGTGGG - Exonic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069490844 10:68859072-68859094 AACTTTCTTCAGCAAATGGCAGG + Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075238099 10:120750046-120750068 TGCTTTCTTCACAAGGTGGCAGG - Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076896096 10:133313013-133313035 AGCTGTCATCAGAAGCTGTGAGG + Exonic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078375939 11:10793057-10793079 AGATGTCATCAGCAGATAGCTGG + Intergenic
1079314894 11:19399271-19399293 ATCTGACTTCTGAAGGTGGCAGG - Intronic
1079725916 11:23880471-23880493 ATCTATCTTCACAAGTTGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083826151 11:65205190-65205212 AGCTGTGAGCAGAAGCTGGCAGG + Intronic
1083833739 11:65250586-65250608 AGCTGTATTCAGAGGAGGGCAGG - Intergenic
1084223353 11:67698525-67698547 AACTCTGTTCAGAAGAGGGCAGG - Intergenic
1085590004 11:77751406-77751428 ACCTGTCTTCAGATGTTGGCTGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086129771 11:83389353-83389375 AGCTTTCTACAAAAGTTGGCAGG + Intergenic
1086496533 11:87410045-87410067 ATCTGTGTTCAGAAAATGCCAGG - Intergenic
1088034796 11:105298413-105298435 ATCTCTCTGCAGAAGATGACAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089152132 11:116372418-116372440 GTCTGTCTTCACACGATGGCAGG - Intergenic
1089677941 11:120102742-120102764 AGCTGTCTGCAGGGGTTGGCCGG - Intergenic
1090070980 11:123544702-123544724 TGCTGGCTTCTGAAGAAGGCAGG - Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090953470 11:131494844-131494866 AGCTGTCACCAGAAGGTGGGTGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092525977 12:9310675-9310697 AGGCGTCCTCAGAAGATGCCTGG - Intergenic
1092784302 12:12013831-12013853 AGGGGTCTTCATAAGATAGCAGG - Intergenic
1092922543 12:13245519-13245541 AGCTGTCTACAGATGACGGCAGG + Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095048072 12:37532683-37532705 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095461600 12:42450017-42450039 AGCTGTGTGCTGAAGATGACAGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104084730 12:125463913-125463935 CACTGTCTTCACAAGGTGGCAGG + Intronic
1104141967 12:125996225-125996247 AGCTGTCTTCACATGCAGGCTGG + Intergenic
1105409424 13:20159634-20159656 AGCTGTCTTAAAAGAATGGCGGG - Intronic
1105729082 13:23193472-23193494 AGCTGTCCTCAGGATGTGGCAGG + Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107223244 13:38012461-38012483 AGCTGTTTTTAAAAGATTGCTGG - Intergenic
1107394087 13:39997104-39997126 AGCAGTGTTCAGACTATGGCAGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108132474 13:47317644-47317666 AGCTTTCTTTAGAGAATGGCAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111533250 13:89568846-89568868 AACCTTCTTCACAAGATGGCAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113770282 13:112903913-112903935 AGGGGGCTTCAGAAGAGGGCAGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115542704 14:34437685-34437707 AGCTGACTCAAGAAGGTGGCAGG + Intronic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116861458 14:49998955-49998977 ACCTGTCATCAGCAGCTGGCAGG + Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119718765 14:76877025-76877047 AGTTGTATTCAGAAGGTGTCTGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120425835 14:84347008-84347030 ATCTTTCTTCAAAAGGTGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120616245 14:86708728-86708750 AACTGTTTTCAGTAGAAGGCAGG - Intergenic
1122498905 14:102181089-102181111 TGCTGTCTCCTGAAGAAGGCTGG + Intronic
1122742606 14:103880884-103880906 AGCTGTCCTCAGGAGAGGGCAGG - Intergenic
1124859643 15:33426409-33426431 TGCTGAGTTCAGAAGATTGCAGG + Intronic
1126091167 15:45053318-45053340 AGCTGTCTTTGGAAGACAGCAGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128925481 15:71651384-71651406 AGCTCTTTTCAGAAGATGTCTGG - Intronic
1129194590 15:73956294-73956316 ACCTGTTTTGAGAAGTTGGCAGG + Intergenic
1130217280 15:81984324-81984346 ATCTATCTTCAGGTGATGGCTGG - Intergenic
1131398714 15:92107682-92107704 TGCTGTCTGCAGAGCATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132112719 15:99114248-99114270 AACCTTCTTCAGAAGGTGGCAGG + Intronic
1132310297 15:100852719-100852741 AGCTGTCATCTGGAGATGCCTGG - Intergenic
1132644354 16:991932-991954 AGCTGGATTCAGAAGCTGCCCGG + Intergenic
1132830068 16:1923657-1923679 AGCTGTCTTCGGCGGAGGGCGGG - Intergenic
1133381745 16:5336709-5336731 AGTTGTCTTTAGAAGCTGACAGG + Intergenic
1133728016 16:8555282-8555304 AGCTGTATTGAGGAGGTGGCAGG + Intergenic
1136125581 16:28177646-28177668 AGCAGTTTTAAGAAGATGGAAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136930073 16:34410593-34410615 AGCTGCCTGCAGTAGAGGGCTGG + Intergenic
1136974501 16:35001212-35001234 AGCTGCCTGCAGTAGAGGGCTGG - Intergenic
1137781244 16:51099369-51099391 CACTTTCTTCACAAGATGGCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141394473 16:83692406-83692428 CCCTGTCATCAGATGATGGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143031836 17:3972346-3972368 AGCTGCCTTGAGAACATGACAGG + Intergenic
1143982041 17:10878524-10878546 GGTTGTTTTCAGGAGATGGCTGG + Intergenic
1145411337 17:22668869-22668891 AGATGTCAGCAGAAAATGGCCGG - Intergenic
1146183440 17:30710694-30710716 GGCTGTCTTCAGATGGGGGCCGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146658210 17:34647798-34647820 GGCTGTGTTCACAAGCTGGCTGG + Intergenic
1148242845 17:46011744-46011766 GGCTGTCTCCAGAAAATGCCTGG + Intronic
1148478698 17:47946047-47946069 AGCTGTCCCCAGGAGATGCCAGG + Intronic
1148858773 17:50593316-50593338 AGCTGCCTTCAGAAGGGGCCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153906577 18:9666971-9666993 AGATGTCTTCAACAAATGGCAGG + Intergenic
1153957909 18:10113713-10113735 AGCTGTCTTCTGAACAGGGCTGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1154962351 18:21322119-21322141 AGCAGAATTCAGAAGGTGGCTGG + Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159603627 18:70452464-70452486 AGCTGAATTAAGAAGAAGGCTGG - Intergenic
1159694611 18:71539502-71539524 AACACTCTTCAGAAGATTGCAGG - Intergenic
1160910736 19:1472679-1472701 AGCTGTCTCCAGAAGGGGACAGG + Exonic
1161503624 19:4632010-4632032 AGCCTTCTTCACAAGACGGCTGG + Intergenic
1161945352 19:7432698-7432720 AGCTGCCTTCAAAAGATGTTTGG + Intronic
1162938754 19:13995542-13995564 GGCTGACTTCAGAACAGGGCCGG + Intronic
1163645693 19:18487877-18487899 AGCTGTGCTCAGAACCTGGCTGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164455293 19:28401762-28401784 AGCTTTCTTGAAAAGGTGGCTGG - Intergenic
1165985599 19:39766177-39766199 CGCTATCTTGAGAAGAAGGCAGG + Intergenic
1167227008 19:48251889-48251911 CTCTGTGTTCAGGAGATGGCTGG - Intronic
1167620550 19:50557668-50557690 AGCAGGTTTCAGAAGAGGGCTGG + Intronic
1167752917 19:51391224-51391246 ATCTGTCTTGAGGATATGGCAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925776503 2:7340729-7340751 GTCTTTCTTCACAAGATGGCAGG - Intergenic
926450370 2:12996425-12996447 AGGTGGATTCAGAGGATGGCTGG + Intergenic
926716600 2:15929008-15929030 AGCTCTCCTGAGAAGAGGGCTGG - Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928435330 2:31251216-31251238 AGCTCTCTTCTGATGAGGGCAGG + Intronic
928725644 2:34171064-34171086 ATCTTTCTTCACAAGGTGGCAGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931812111 2:65864091-65864113 AGCAGTGTGCAGAAGATGGCAGG + Intergenic
931916635 2:66963335-66963357 ACCTGTCTACAGAGGATGTCAGG - Intergenic
931963286 2:67505145-67505167 CGCTGTCTTCACAGGGTGGCAGG - Intergenic
932355752 2:71067638-71067660 GGGTTTCTCCAGAAGATGGCAGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935325076 2:101928430-101928452 CACTTTCTTCACAAGATGGCAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
938858128 2:135337166-135337188 AGCTGTCTTCTGACCATGGTGGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940072353 2:149702840-149702862 AGCAGGCTTCAAAAGTTGGCAGG + Intergenic
941261069 2:163298142-163298164 AGCTGTGTTCATAAGAAGGTAGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943256621 2:185601954-185601976 CACTTTCTTCACAAGATGGCTGG + Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946037207 2:216753669-216753691 AGCTGTCATCTGAATATGGCAGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948295177 2:236855334-236855356 AGCTGCCTGGAGAAGATGCCTGG - Intergenic
948619932 2:239227916-239227938 ATGTGTCTTGAGAAGATGCCTGG - Intronic
948963557 2:241358215-241358237 AGCTGTGTTAACAAGATGCCTGG + Intronic
1171210666 20:23314551-23314573 GGCTATCTTCAGCTGATGGCTGG + Intergenic
1171542616 20:25976153-25976175 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1171798444 20:29584370-29584392 AGATGTCAGCAGAAAATGGCAGG + Intergenic
1171845651 20:30272803-30272825 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1173123884 20:40318936-40318958 TGCTTTCTTCACAAGATGGCAGG + Intergenic
1173127664 20:40354828-40354850 ATCTGTCTAGAGAGGATGGCAGG + Intergenic
1174251747 20:49225183-49225205 TGCTACCTTCAGAAGAGGGCGGG - Exonic
1174654237 20:52157023-52157045 AGCTGGCTGGAGAAGCTGGCTGG - Intronic
1175023198 20:55873482-55873504 AGCTGTCATCAAAAGACGGGAGG - Intergenic
1176208921 20:63907605-63907627 GGCTCTGTTCAGTAGATGGCAGG + Intronic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177470044 21:21548709-21548731 AGCTATCTTCAGATAATGCCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177899656 21:26898798-26898820 CACTTTCTTCACAAGATGGCTGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1182121522 22:27790362-27790384 TCCTGTCATCGGAAGATGGCAGG + Intronic
1184109504 22:42386854-42386876 AGCTGCCACCAGGAGATGGCTGG + Intronic
1184117144 22:42428835-42428857 AGCTGTCACCAGAAGAAGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949353570 3:3152466-3152488 AGCTGTGTTCTGTAGAAGGCCGG + Exonic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951109297 3:18783240-18783262 AGCTGTACTCAGGTGATGGCTGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954204701 3:49049792-49049814 AGATCTCTTCAGAATCTGGCCGG - Intronic
954532581 3:51333580-51333602 AGCTGTCTCCAGAGCAGGGCAGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957122545 3:76113890-76113912 AGCTGTGTTTAGAAAAAGGCTGG + Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957471966 3:80669399-80669421 ATCTTTCTTCACAAGATGGCAGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960079499 3:113526199-113526221 AGCTGTCTTCAGATTATAGGAGG + Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962630090 3:137266745-137266767 ATCTTCCTTCAAAAGATGGCTGG - Intergenic
963177050 3:142309631-142309653 TGGAGTTTTCAGAAGATGGCAGG + Exonic
963588166 3:147221284-147221306 AGTTGTCTTCATAATAAGGCTGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964324575 3:155532643-155532665 CACCTTCTTCAGAAGATGGCAGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965092716 3:164182800-164182822 ATCTTTCTTCACAAGATGGCAGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965858072 3:173113211-173113233 AGCTGTCTTTAAAAAATTGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966463670 3:180204558-180204580 CACTGTCTTCACAAGGTGGCAGG - Intergenic
966465597 3:180228097-180228119 AGCTTCCTTCAGAAGAAGGAAGG - Intergenic
968693553 4:2008985-2009007 AGGTGTCTTCATAAGATGCCGGG - Exonic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971780593 4:31029318-31029340 AGCTTGCTTCTGAAGATGGTGGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
973638489 4:52881151-52881173 AGCAGTCTTCAGAGGCTAGCAGG + Intronic
973955125 4:56055835-56055857 ATCTGCCTTCACCAGATGGCTGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974359367 4:60856393-60856415 AGATGTGGTCAGAAGGTGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977015852 4:91692769-91692791 CACTTTCTTCACAAGATGGCAGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983874092 4:172856070-172856092 AGCTGTTTTCAATAGATGGCTGG - Intronic
983976652 4:173942994-173943016 AGTTGTCTTCAGAAAATCCCTGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986691787 5:10319369-10319391 ACCTGTGTTCAAAAAATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987011284 5:13768310-13768332 CACTTTCTTCACAAGATGGCGGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988076972 5:26365511-26365533 AGATTTCTTCAAAAGGTGGCAGG - Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993707133 5:91183810-91183832 TACTGTCTTCATAAGTTGGCTGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994167864 5:96626573-96626595 AGCAGTCCTGAGAAGATGGGAGG - Intronic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995945477 5:117639788-117639810 AGCTGACTACAGAGGATGACAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996221289 5:120936241-120936263 TGCTGTCTTTAGAACATTGCTGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997965755 5:138354362-138354384 CGCTTTCTTTAAAAGATGGCTGG + Intronic
998059766 5:139110777-139110799 CCCTGTCTTCAGAAGAGGGAAGG + Intronic
998501671 5:142638091-142638113 AGCTGTCCTCAGGAAATGACTGG - Intronic
998747167 5:145273802-145273824 AGCTTCCTCCAGAAGGTGGCAGG + Intergenic
998756798 5:145390417-145390439 ACCTCTCTTCACAAGCTGGCAGG + Intergenic
999045934 5:148469536-148469558 AGCTGGCTTCAGAATGTGCCAGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000730198 5:164825685-164825707 TGGTGTCTACAGAAGATGGGAGG + Intergenic
1000940229 5:167351734-167351756 AGCTGTTTTCAAAAGTTTGCTGG + Intronic
1000952422 5:167500701-167500723 AGCTGTATCTAGAAGATGACAGG + Intronic
1001094010 5:168762363-168762385 AGCTGTCCACAGGAGATGCCTGG + Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001779477 5:174355551-174355573 GGCTGTCCTCAGAAGATTCCAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006343609 6:33461962-33461984 AGATGTCTACAGCATATGGCTGG - Intergenic
1006425802 6:33962232-33962254 AGCTGTATTAAGCAGATGACAGG - Intergenic
1006837937 6:37010507-37010529 AGCTGCAGTCAGAGGATGGCTGG + Intronic
1007098545 6:39229176-39229198 AGCTGTTTTCAGAGGCTGGAGGG - Exonic
1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011886603 6:92104181-92104203 CACTTTCTTCACAAGATGGCAGG - Intergenic
1012131687 6:95501071-95501093 AGCTGGCTGGAGAAGCTGGCTGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1017984066 6:159427076-159427098 ATCCTTCTTCACAAGATGGCAGG - Intergenic
1018469531 6:164083353-164083375 TGCAGACTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020019825 7:4857520-4857542 AGCTGAATCCAGAAGAAGGCAGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021787031 7:24162798-24162820 CACTGTCTTCAAAAGATGGCAGG - Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024354253 7:48397988-48398010 TGCTGTCTTCAGAGAATGGCTGG + Intronic
1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026964199 7:74429061-74429083 AGCTGTGTTCAGAACATCACTGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028473028 7:91225024-91225046 AGCTGCAATCAGATGATGGCTGG + Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032077489 7:128842990-128843012 AGCTGCCTTCTGGAGCTGGCAGG - Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033027556 7:137790676-137790698 AGCAGGACTCAGAAGATGGCTGG + Intronic
1035078296 7:156195520-156195542 AGCTGTATTCAGAAACTGACAGG + Intergenic
1035934191 8:3818644-3818666 TGCTGTCATCAGACGATGCCGGG - Intronic
1037349726 8:17938960-17938982 AGGTGTCTGAAGAAGATGGGAGG + Exonic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037893052 8:22634102-22634124 AGCTGTCTGCAGAAGCAGGAAGG + Intronic
1038443848 8:27589444-27589466 AGCTCCCTTCTGAAGAGGGCTGG - Intergenic
1038558393 8:28545623-28545645 AGCTGCAGTCAGATGATGGCTGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043289024 8:78572593-78572615 AGCAGTCTTCAAAAGAGGCCTGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045039845 8:98212930-98212952 AGCTGTCTAGAGAGGAAGGCAGG - Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045349103 8:101322217-101322239 TGCCTTCTTCACAAGATGGCAGG + Intergenic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048125026 8:131624849-131624871 TGCTGTTTACAGAAGATGGAAGG + Intergenic
1049002249 8:139833511-139833533 GGCTGACTTCAGAGGTTGGCAGG + Intronic
1049415491 8:142493035-142493057 AGCTGTCCTCGCAAGATCGCTGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050867995 9:10528723-10528745 AACTGCCTTCAGAAGAAGTCAGG - Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052746540 9:32447540-32447562 AGCAGGCTTCAGAAGGTGGGTGG - Intronic
1053024805 9:34720604-34720626 AGCTGCCCTGAGAAGATGGAAGG - Intergenic
1053242097 9:36504388-36504410 TCCTGTCCTCACAAGATGGCAGG + Intergenic
1053280243 9:36815928-36815950 AGCAGTCCTCAGAAGAAAGCTGG - Intergenic
1054162426 9:61683043-61683065 AGATGTCAGCAGAAAATGGCAGG + Intergenic
1054702315 9:68425288-68425310 AATTGTTTTCAAAAGATGGCAGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057791257 9:98126678-98126700 AGCTGGCTGCAGAAGATGGCTGG - Exonic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187258113 X:17659579-17659601 AACTGTTTTCATAAGATGCCAGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188129564 X:26414653-26414675 CGCTTTCTTCACAAGGTGGCAGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192593494 X:72382353-72382375 ATCTGTCTTAATAGGATGGCAGG - Intronic
1192896717 X:75450688-75450710 AGTGGTTTTCAGAAGATGGGAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196648623 X:118146169-118146191 ATCTGTCTCCAGAAAAAGGCTGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198741516 X:139848063-139848085 AGATTTCATCAGATGATGGCAGG - Intronic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199303214 X:146236945-146236967 AGCTATATTCAGGACATGGCAGG - Intergenic
1199428726 X:147734178-147734200 AGCTGCAGTCAGAAGATGACTGG - Intergenic
1199826725 X:151507768-151507790 AGCTGTCTGCAGTAGATTACAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200702315 Y:6412680-6412702 GGGTGTCATCAAAAGATGGCTGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200962879 Y:9011220-9011242 GGGTGTCTGCAAAAGATGGCTGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201031796 Y:9752018-9752040 GGGTGTCATCAAAAGATGGCTGG - Intergenic
1201475252 Y:14374719-14374741 AGCTTTCTTTACAAGGTGGCAGG - Intergenic
1201694409 Y:16808889-16808911 AGTTGTCTTCAGAAGTGGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202048839 Y:20760339-20760361 AGCTGTCCTCAGGTGTTGGCTGG + Intronic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic
1202150227 Y:21837561-21837583 GGGTGTCTGCAAAAGATGGCTGG + Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic