ID: 1014539681

View in Genome Browser
Species Human (GRCh38)
Location 6:122660167-122660189
Sequence AAACCCACCTTAATTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014539681_1014539686 8 Left 1014539681 6:122660167-122660189 CCCCCACCAATTAAGGTGGGTTT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1014539686 6:122660198-122660220 CATATGCACTTCCACTATTGTGG 0: 1
1: 0
2: 3
3: 2
4: 82
1014539681_1014539687 17 Left 1014539681 6:122660167-122660189 CCCCCACCAATTAAGGTGGGTTT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1014539687 6:122660207-122660229 TTCCACTATTGTGGACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014539681 Original CRISPR AAACCCACCTTAATTGGTGG GGG (reversed) Intronic
901538845 1:9901596-9901618 AAAAACACCTTAATTGGAGCTGG + Intronic
903547683 1:24136947-24136969 GAACACACTGTAATTGGTGGGGG + Intronic
904851409 1:33462488-33462510 AAAACCATTTGAATTGGTGGTGG + Intergenic
910723367 1:90312155-90312177 CAAGTCACCTTAAATGGTGGGGG - Intergenic
911007446 1:93241931-93241953 AAACCCTCATTCATTGCTGGAGG + Intronic
913528444 1:119714920-119714942 AAACACATCTTTGTTGGTGGAGG - Intronic
916270957 1:162940978-162941000 AAACCCTCCATACTTGGTGTAGG + Intergenic
917466361 1:175280358-175280380 AAACTCACATTTATTGCTGGTGG + Intergenic
918699395 1:187589182-187589204 ACACCCACCTACATTGGTGATGG - Intergenic
918735070 1:188050413-188050435 AAACCCTCATTAATTGCTGGTGG - Intergenic
918969889 1:191400237-191400259 AAACTCACATTAATTGCCGGTGG + Intergenic
920806186 1:209236115-209236137 AAACCCACCAAAACTGGTTGTGG - Intergenic
1062973221 10:1664417-1664439 AAACCCTCATTCATTGCTGGTGG - Intronic
1068143815 10:53040084-53040106 AAACCCACATACATTGCTGGTGG - Intergenic
1071468036 10:85958608-85958630 AAGCCCACCTACATTAGTGGGGG - Intronic
1072646640 10:97260667-97260689 AAACCCTCCTATATTGCTGGTGG + Intronic
1072752466 10:97992225-97992247 CAGCCCACCTTATTTGGAGGGGG + Intronic
1073091832 10:100948042-100948064 ACAACCACCCTAAGTGGTGGAGG - Intronic
1073675825 10:105646186-105646208 AAGCCCACCTTAAATGTTTGGGG + Intergenic
1076304338 10:129453688-129453710 ACACACAGCGTAATTGGTGGAGG + Intergenic
1077403641 11:2371616-2371638 GAACCCTCCTTCATTGCTGGTGG - Intergenic
1080197036 11:29623418-29623440 AAACCCACCTTAGTAGTAGGGGG + Intergenic
1080280757 11:30554208-30554230 AAACCCACCCTGATTGTAGGTGG + Intronic
1084143173 11:67247927-67247949 AAACCCACCTTATAGGGTTGTGG - Intronic
1085223503 11:74896390-74896412 AAACCCCCATGAACTGGTGGTGG + Intronic
1085757457 11:79213566-79213588 AAACTCATCTAAATTGGAGGAGG - Intronic
1088125095 11:106414799-106414821 AAATGCACCTTATTTGGTGAAGG + Intergenic
1090281057 11:125456177-125456199 AGTCCCATCTTGATTGGTGGTGG - Intronic
1091356125 11:134938940-134938962 CAACCCGCCTTATTTTGTGGTGG - Intergenic
1092003648 12:5050985-5051007 AATCCTGCCTTAATTGGAGGCGG - Intergenic
1092535700 12:9384994-9385016 AAACCCACATAGATTGCTGGTGG - Intergenic
1093020165 12:14196019-14196041 AAACCCTCATTCATTGCTGGTGG + Intergenic
1093780571 12:23132221-23132243 ATACCCACCTACATTGGTGAGGG - Intergenic
1095247295 12:39937803-39937825 AAAGCCTCCTTAGATGGTGGGGG - Intronic
1096224299 12:49855227-49855249 AATGTCACCTTAATGGGTGGAGG + Intergenic
1099974757 12:89534673-89534695 AAACCCTCATAAATTGCTGGTGG + Intergenic
1102077624 12:110072802-110072824 AATCCCAGCTTACTTGGTGGCGG + Intronic
1102527151 12:113520200-113520222 AAACCCTCCTTAATGGAGGGCGG - Intergenic
1104315086 12:127691100-127691122 AAACCCTCCGTAATCTGTGGTGG + Intergenic
1106202731 13:27554842-27554864 AAACCCTCATTAATTGCTGGTGG - Intronic
1111659734 13:91194006-91194028 AAACCCACCTTAAGACATGGCGG + Intergenic
1112230424 13:97584082-97584104 AAGCCCACCTGACTTGGGGGAGG - Intergenic
1115126300 14:29998598-29998620 AAATCCATCTTAATTTTTGGTGG + Intronic
1115804523 14:37035911-37035933 AAAACAACCTTACTTGCTGGTGG - Intronic
1116981390 14:51174681-51174703 ATGCCCACCTACATTGGTGGGGG - Intergenic
1118388458 14:65276523-65276545 AAATCTACATTATTTGGTGGTGG - Intergenic
1118516515 14:66534657-66534679 AAACCCTCCTACATTGCTGGTGG - Intronic
1118530167 14:66695408-66695430 AAACTCTCATTAATTGCTGGTGG + Intronic
1123668989 15:22635182-22635204 AATCCCACATAAATTGCTGGTGG - Intergenic
1132405583 15:101540371-101540393 AAACCCACCTTGATTGGTTCAGG - Intergenic
1133069973 16:3239608-3239630 AAACCCTCCTATATTGCTGGTGG + Intergenic
1139338387 16:66249926-66249948 GTACCCACCTTTCTTGGTGGTGG + Intergenic
1140892807 16:79299219-79299241 AAACCCGCATTAATGGGAGGTGG - Intergenic
1141088279 16:81112097-81112119 AAACCAAGGCTAATTGGTGGTGG - Intergenic
1141800225 16:86303017-86303039 AAGCCTACCTTAATTGATAGAGG + Intergenic
1144018594 17:11220552-11220574 TATTCCACCTTAATTTGTGGTGG - Intergenic
1146975773 17:37110379-37110401 AAACCCACCTCAATTCTGGGTGG + Intronic
1148344631 17:46895055-46895077 GATCCCACCTTCCTTGGTGGTGG + Intergenic
1150913509 17:69413067-69413089 CAACCCACCTTGATTGCTGAGGG + Intergenic
1153223438 18:2880904-2880926 AATTATACCTTAATTGGTGGAGG - Intronic
1159666982 18:71173581-71173603 ACACCCACCTACATTGGTGAGGG - Intergenic
1160089180 18:75809936-75809958 AAACCAGCTTTAATTGGTGAAGG - Intergenic
1163947056 19:20547767-20547789 AAACCCATGTTGATTGCTGGTGG + Intronic
1163974177 19:20833570-20833592 AAACCCATGTTAATTGTTGGTGG + Intronic
1165221138 19:34317562-34317584 AACTCCACCTTAACTGGTGTAGG - Intronic
1168150594 19:54445642-54445664 AAACCCTTCTTCATTGGTGCTGG + Intergenic
927620312 2:24649427-24649449 AAATCCACTTTAATTTGTGTTGG - Intronic
928695853 2:33849266-33849288 AAACCTGACTTAATTGCTGGGGG + Intergenic
931873924 2:66491467-66491489 TATTCCACCTTAATGGGTGGGGG + Intronic
933104828 2:78311258-78311280 ATGCCCACCCTAATTGGTGAGGG - Intergenic
944302667 2:198142120-198142142 AAAACCATTTTCATTGGTGGGGG + Intronic
944344049 2:198639199-198639221 ATGCCTACCTGAATTGGTGGGGG - Intergenic
944982321 2:205135384-205135406 AATACTACCTTAATTGATGGTGG + Intronic
945412129 2:209522876-209522898 AAGCCCACAATTATTGGTGGTGG + Intronic
1171245212 20:23605473-23605495 AAAACTACCGTAATTGGTTGTGG + Intronic
1183247061 22:36702223-36702245 CAACCAACCTTGATTGGTGGTGG + Intronic
949126100 3:446718-446740 AGACCCACCTTAATTTGGGTGGG - Intergenic
955592468 3:60552437-60552459 GAACCCTCTTTCATTGGTGGTGG - Intronic
956898050 3:73683942-73683964 AGACCCACCCTCAGTGGTGGTGG - Intergenic
957549328 3:81683580-81683602 AAACCCAGATTAATTAGTGGTGG + Intronic
958086748 3:88818920-88818942 AAACTCTCATTAATTGCTGGTGG - Intergenic
959034143 3:101340173-101340195 AATCCCCCCTTAGTAGGTGGTGG + Exonic
968063142 3:195741440-195741462 GAACCCTCCTTCATTGCTGGTGG - Intergenic
969268867 4:6085361-6085383 AATGCCACCTAAATGGGTGGGGG + Intronic
970013245 4:11483803-11483825 AAAACCATCTTAATTTGTTGTGG - Intergenic
977012332 4:91653508-91653530 AAACCCACCCTCATTGTGGGTGG + Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
985843065 5:2324211-2324233 ATTCCCACCTGAAATGGTGGAGG + Intergenic
985867349 5:2524399-2524421 AAGCCCACCTAGAGTGGTGGTGG - Intergenic
986389777 5:7274170-7274192 AATCACACCTTAATTAGAGGCGG + Intergenic
996619452 5:125482366-125482388 AAAAACACATTTATTGGTGGTGG + Intergenic
1002768521 6:266441-266463 GAACCCTCCTTAATTGGTGGAGG + Intergenic
1004150982 6:13119936-13119958 AAACCCACCTTTATTTATGAGGG + Intronic
1005335094 6:24788224-24788246 AAACCCTCCTGCAGTGGTGGTGG + Intergenic
1008562303 6:52735089-52735111 AGACCCACCTTCAATGTTGGGGG + Intergenic
1011300041 6:85864207-85864229 ATACCCAGTTTATTTGGTGGGGG + Intergenic
1011329479 6:86187785-86187807 AAGCCTCCCTTAAATGGTGGGGG - Intergenic
1012228860 6:96737077-96737099 ATACCCACCTGCATTGGTGAAGG - Intergenic
1014539681 6:122660167-122660189 AAACCCACCTTAATTGGTGGGGG - Intronic
1019739069 7:2663892-2663914 AACCCCACCTCAGTAGGTGGAGG + Exonic
1021081861 7:16374153-16374175 AAACCCACCTTCAATGTGGGTGG + Intronic
1024062166 7:45707084-45707106 AAACTCTCCTTCATTGCTGGTGG + Intronic
1031279752 7:119783258-119783280 AAATCCACATTTATTGATGGTGG - Intergenic
1039407224 8:37323805-37323827 AAACACACCTTCCTTTGTGGGGG + Intergenic
1042518293 8:69682996-69683018 AAACCCACCATATTTGATTGTGG - Intronic
1042805608 8:72767827-72767849 AAACCCTCTTTCATTGCTGGTGG - Intronic
1043149800 8:76700880-76700902 AAAATCACCTTAAATGGTGAAGG + Intronic
1047580254 8:126206235-126206257 AAACCCACCCTCAATGTTGGTGG + Intergenic
1051370974 9:16358780-16358802 CAACCTGCCTTATTTGGTGGTGG - Intergenic
1055935498 9:81600804-81600826 ATACCCACCTGCACTGGTGGGGG - Intronic
1057498619 9:95579449-95579471 ACACCCACCCTCATTGGTGAGGG - Intergenic
1058667552 9:107334383-107334405 ACACCCACCTGCATTGGTGAGGG + Intergenic
1062319349 9:135982825-135982847 AGACCCACCTTAGCAGGTGGTGG - Intergenic
1185536520 X:866800-866822 AAACCCAAGCTAATTAGTGGCGG - Intergenic
1190005823 X:46737067-46737089 AAACCCACTGTAATTGGGGAAGG - Intronic
1190007690 X:46756179-46756201 GAACCCAACTTAATTTCTGGAGG - Intronic
1194882816 X:99274525-99274547 AAACCCCCATAAGTTGGTGGTGG + Intergenic
1195146873 X:102026943-102026965 AAACCCACCCTGCCTGGTGGAGG + Intergenic
1199595266 X:149502012-149502034 AAACCCACCTTGCTTGCTGTTGG + Intronic
1201955551 Y:19618530-19618552 AAACCCCCTGTACTTGGTGGGGG - Intergenic