ID: 1014540683

View in Genome Browser
Species Human (GRCh38)
Location 6:122672052-122672074
Sequence TTGTCCATCAAAAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014540680_1014540683 -5 Left 1014540680 6:122672034-122672056 CCTGCAAGCAAATACTGATTGTC 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014540683 Original CRISPR TTGTCCATCAAAAAGGAGGA TGG Intronic
903790371 1:25888831-25888853 TGTTCCAGGAAAAAGGAGGATGG + Intronic
905087035 1:35389933-35389955 TTGGCCATCTAAAAAGAAGAAGG - Exonic
905657115 1:39692125-39692147 GGGTCCATGAGAAAGGAGGAGGG - Intergenic
907132832 1:52111740-52111762 TTGACAATCAGAAAAGAGGAAGG - Intergenic
907643671 1:56218796-56218818 TTGTGCCTCACAAAGTAGGAGGG + Intergenic
909501664 1:76341202-76341224 CTGTCAACCAAAACGGAGGAGGG - Intronic
910738250 1:90486310-90486332 TTCTCACTCTAAAAGGAGGAAGG - Intergenic
911511562 1:98813249-98813271 ATGTCCAACCAAAAGGAGGCTGG + Intergenic
912374693 1:109200716-109200738 TAGTCTATAAAACAGGAGGATGG - Exonic
913583476 1:120250011-120250033 TTGTGAATCAAAAAGAAAGACGG - Intergenic
913624699 1:120648308-120648330 TTGTGAATCAAAAAGAAAGACGG + Intergenic
914565463 1:148861848-148861870 TTGTGAATCAAAAAGAAAGACGG - Intronic
914607362 1:149268401-149268423 TTGTGAATCAAAAAGAAAGACGG + Intergenic
914964702 1:152244966-152244988 TTGTATATCAAAAAGGATGCAGG + Intergenic
916115506 1:161481945-161481967 CTGTCCATCCAGAAGGAGGTTGG - Intergenic
916453685 1:164948181-164948203 TTATCCATTAAAAATGAAGAAGG - Intergenic
917307195 1:173638707-173638729 TTTTAAATCAAAAAGCAGGAAGG + Intronic
920179808 1:204125703-204125725 TTGGCCATCAGAAAGCAGGCTGG + Intronic
920383631 1:205550912-205550934 CTGTCCAAAAAAAAGAAGGAAGG + Intergenic
920984282 1:210870874-210870896 TTGTTCATCTTAAAGAAGGATGG - Intronic
921544573 1:216459297-216459319 TTTTCCAAAGAAAAGGAGGAAGG - Intergenic
921922553 1:220685741-220685763 GTGTCCTTCTAAAAAGAGGAAGG + Intergenic
921981646 1:221264866-221264888 TTTTCCTTGAAAGAGGAGGAGGG - Intergenic
923314699 1:232768521-232768543 TTGTCCATCAAGCAGGAGGATGG - Intergenic
924072984 1:240301602-240301624 ATGTCCTTCAAAAAAAAGGAAGG - Intronic
924543734 1:245005910-245005932 GTGTCCGTCACAAAGGCGGAGGG + Intronic
1063534296 10:6868081-6868103 TTGTCCAGAAAATAAGAGGAAGG - Intergenic
1064113924 10:12561502-12561524 GTATGCAGCAAAAAGGAGGAAGG - Intronic
1066245546 10:33580323-33580345 TTGTCCATTAAAATGTAGAAAGG + Intergenic
1066326950 10:34369986-34370008 TTGGCCATCAAAAGGTAGAAAGG + Intronic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1067758051 10:49020672-49020694 TGTACCATCAAAAAGAAGGAAGG + Intronic
1068914857 10:62419340-62419362 TTATCAATCTAAAAGGAAGACGG + Intronic
1072369324 10:94747773-94747795 TAGTTCATCAAAAGGGAGGAGGG + Intronic
1073863535 10:107774189-107774211 TTTTCCAAAAAAGAGGAGGAGGG + Intergenic
1074458662 10:113616953-113616975 TTTTGCATCATAAAGGAGTATGG + Intronic
1075471789 10:122696547-122696569 TTGGCCATCAACAAGGAGGATGG - Intergenic
1078410640 11:11114081-11114103 TAGTACATAAGAAAGGAGGAGGG - Intergenic
1079917629 11:26390304-26390326 TTTTCCCTCTAAAAGGAGGAGGG - Intronic
1081388403 11:42500524-42500546 TTGTCCAGATATAAGGAGGAGGG + Intergenic
1082976580 11:59078586-59078608 TTTTTCGTCACAAAGGAGGAAGG + Intergenic
1083375766 11:62219263-62219285 TTTTAAATCAAAAAGCAGGAAGG + Intergenic
1083422224 11:62560475-62560497 GGGTCAATCAATAAGGAGGAAGG + Intronic
1083545566 11:63546488-63546510 TTCTGAATCACAAAGGAGGAAGG + Intergenic
1085456595 11:76668970-76668992 CTCTCTCTCAAAAAGGAGGACGG + Intronic
1086391336 11:86367193-86367215 TTGAACCTCAAAAAGGAAGAAGG - Intergenic
1088917731 11:114240057-114240079 CTGGCCAACAAAAAGCAGGAAGG - Intronic
1089637408 11:119824217-119824239 TTATACATCAAAGAGGATGATGG + Intergenic
1089887688 11:121844109-121844131 TTGGCCAGCAGGAAGGAGGAAGG + Intergenic
1091820920 12:3474597-3474619 TAGTCAAGCAAAGAGGAGGAAGG - Intronic
1094143846 12:27208384-27208406 TTTTCCATTACATAGGAGGAAGG + Intergenic
1098763120 12:74449934-74449956 TAGGCCATTAAAAAGGAGGTAGG + Intergenic
1099012214 12:77305271-77305293 TGATCCAACAAAAAGGTGGAGGG + Intergenic
1101382242 12:104224191-104224213 TTGCCCAGCAAAGAGAAGGAAGG - Intronic
1102106940 12:110333361-110333383 TTGACTTTCAAAAGGGAGGAAGG - Intronic
1103976833 12:124708074-124708096 CTGGCCAGCAGAAAGGAGGAGGG - Intergenic
1105231723 13:18502551-18502573 TTGTCCCTCACAAAGGATGCTGG - Intergenic
1106736212 13:32590264-32590286 TTATCCGTCAAAAAAGAGAATGG - Intronic
1109912231 13:68929426-68929448 TTGTCCAATAAAAATGAAGAGGG - Intergenic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110195426 13:72782514-72782536 TTTCCCTTCAAAAAGAAGGAGGG + Intronic
1110963368 13:81658982-81659004 TCCTCCATAAAAAGGGAGGAAGG + Intergenic
1111523988 13:89443483-89443505 ATGTCCATCAAAAATGTGCATGG - Intergenic
1113454080 13:110435096-110435118 TGTTCCATCAAAAAGCAGAAGGG - Intronic
1114017274 14:18442356-18442378 TTGTCCATCACAAAGGATTCCGG - Intergenic
1114019451 14:18464207-18464229 TTGTCCCTCACAAAGGATGCTGG - Intergenic
1114023331 14:18501129-18501151 TTGTCCATCAAAAAGGATTCAGG + Intergenic
1114026972 14:18536712-18536734 TTGTCCCTCAAAAAGGATTCCGG + Intergenic
1114181425 14:20371264-20371286 TTGTCCACCCACAAGGAGTATGG - Exonic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1117435866 14:55714724-55714746 ATGTCCATCAAAGAGAAGAATGG - Intergenic
1119441695 14:74632657-74632679 TTGTACATTAAAAAAGAGTAAGG - Intergenic
1119708566 14:76804114-76804136 ATGTCCATGAAACAGGAGGAGGG + Intronic
1119727204 14:76928751-76928773 CTGTCCATCAAAGAGGGGGATGG - Intergenic
1121465772 14:94114763-94114785 TTGCCCATCTAAAGGGAGGCAGG - Intronic
1122185838 14:99994883-99994905 CTGTCCTTCAAAATGAAGGAAGG - Intronic
1122936495 14:104960077-104960099 TTGTAAAACAAAAAGGAGGCTGG + Intronic
1124923096 15:34045527-34045549 TTGTCCTTGAAAAGGAAGGAGGG + Intronic
1126694303 15:51313319-51313341 TTGGCCTTCAAATAGGAGGCTGG + Intronic
1128539833 15:68518739-68518761 CTCTCCATCAGAAAGGAGCAAGG - Intergenic
1128660726 15:69499253-69499275 TTTGCAATTAAAAAGGAGGAAGG - Intergenic
1129618449 15:77120190-77120212 TTGTCAATGAAAAACTAGGATGG - Intronic
1129905285 15:79182948-79182970 TTGTCTCTGAAAAAGAAGGAAGG - Intergenic
1130448532 15:84027904-84027926 TTGACCATCAAAAGGAATGAAGG + Intronic
1130539523 15:84812156-84812178 TTGACCATCACAAGTGAGGAAGG + Intergenic
1133248668 16:4465841-4465863 TTCTCCTTCAAAGATGAGGAGGG - Intronic
1133591825 16:7252168-7252190 TACATCATCAAAAAGGAGGAAGG + Intronic
1133647785 16:7780634-7780656 ATGTCCTTAAAAAAGGAAGAAGG - Intergenic
1133686788 16:8172726-8172748 TTCTCCATCATAAAGTTGGAAGG - Intergenic
1135396439 16:22135354-22135376 TTGTCCATGTAAGAGGAGAAGGG - Intronic
1137925359 16:52535420-52535442 TTGACCAGCAAGAAGGACGAAGG - Intronic
1141593105 16:85081684-85081706 TTGTCCAGCAAACAGCAGGGTGG - Intronic
1144789667 17:17850399-17850421 TTTTACATCAAAAATCAGGAAGG + Intronic
1144790102 17:17853039-17853061 TTGCCCATCAAAAGGCAGTAGGG + Intronic
1144886283 17:18464741-18464763 TTGTCAAAAAAAAAGAAGGAAGG + Intergenic
1147275843 17:39315735-39315757 TTGTCCGTGCAACAGGAGGAAGG + Intronic
1147303208 17:39546095-39546117 TGTTCCATAAAAAAGGAGGAAGG - Intronic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147767199 17:42844991-42845013 TTGTCCACCAAAGAGGACGATGG - Exonic
1148246103 17:46031935-46031957 TTGTCCCTTCAAAAGGGGGAGGG + Intronic
1148256698 17:46139818-46139840 CTGTCCTTAAAAAAAGAGGAAGG + Intronic
1148799198 17:50212481-50212503 TTCTCCAGCAAAAGGGAGGGAGG - Intergenic
1150202511 17:63372030-63372052 TTATCCAGCAAAGGGGAGGAGGG + Intronic
1152807798 17:82365233-82365255 TAGTCCTTCAAGAAGGAGGTGGG + Intergenic
1153985340 18:10345900-10345922 TTGACCATCAGAGAGGAGGCAGG + Intergenic
1154521593 18:15236154-15236176 TTGTCCCTCACAAAGGATGCTGG + Intergenic
1157909153 18:51598770-51598792 TCTTCCATCAAAAAAGAGGTGGG - Intergenic
1158445252 18:57514410-57514432 TGATCCATAAAAAAGGATGAGGG - Intergenic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1165278873 19:34780056-34780078 AAGTCCATCAGAAAGGAGTAGGG - Intergenic
1166554107 19:43686689-43686711 TGGTCCATCAGAAAGGGAGAGGG + Intergenic
1166812949 19:45525105-45525127 TTTTCCATCAACAAGAAAGAGGG + Intronic
927389597 2:22580391-22580413 TTGTCCAAGAAAAAGGATTAGGG - Intergenic
927679041 2:25128058-25128080 TTGTCCATCAGAAGGCAGAATGG - Intronic
927778899 2:25923736-25923758 GTGTCCATCACCCAGGAGGATGG - Intergenic
931395375 2:61883967-61883989 TTGTCCTACAAAAAGGACAATGG + Intronic
932144521 2:69306450-69306472 GTATCCATCAAAAACCAGGAAGG + Intergenic
932544046 2:72688453-72688475 TTGCCCACCAGGAAGGAGGATGG - Intronic
934769564 2:96899201-96899223 TTGTACTGCAAAAAGGAGAAAGG - Intronic
934880161 2:97969997-97970019 TTCTTCATCAACAAGGAGAATGG - Intronic
936918554 2:117664424-117664446 TGGTCTATGCAAAAGGAGGAAGG - Intergenic
938520962 2:132069919-132069941 TTGTCCCTCACAAAGGATGCTGG + Intergenic
939246270 2:139627152-139627174 TTGTGCATGAAAAAGGAGGCTGG + Intergenic
939367447 2:141251402-141251424 TTGTGGATAATAAAGGAGGAGGG + Intronic
939459434 2:142480234-142480256 TTGGGCATGAAAAATGAGGAAGG + Intergenic
941067387 2:160919005-160919027 AAGTCAAACAAAAAGGAGGATGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
948157308 2:235793644-235793666 TTGAGCAGCAAAAAGGAGGAAGG + Intronic
948496051 2:238350666-238350688 GTCTCCACCACAAAGGAGGATGG + Intronic
1169951806 20:11052732-11052754 TTGTCCATAGAAAGGGATGAAGG + Intergenic
1170793852 20:19529689-19529711 TTATCTGTCAAACAGGAGGAAGG - Intronic
1173001989 20:39111473-39111495 TGGTGCAGGAAAAAGGAGGATGG + Intergenic
1174339604 20:49887613-49887635 GTGTCATTCAGAAAGGAGGAGGG - Intronic
1174917648 20:54670159-54670181 TTGGCCCTCAAAAAGAATGATGG + Intergenic
1176775698 21:13130900-13130922 TTGTCCCTCACAAAGGATGCTGG - Intergenic
1178437101 21:32569621-32569643 CTGTCCAACAGAAAAGAGGAAGG - Intergenic
1178600547 21:33990814-33990836 TTTTCCCTCAGAAAGGAGGAGGG + Intergenic
1179226086 21:39454673-39454695 CTGTCAATCAAAATGGAGAAAGG - Intronic
1179567732 21:42259816-42259838 TCTTCCATCCAAAGGGAGGAGGG - Intronic
1180441780 22:15373225-15373247 TTGTCCATCACAAAGGATTCTGG - Intergenic
1180443953 22:15395032-15395054 TTGTCCCTCACAAAGGATGCTGG - Intergenic
1180447433 22:15428085-15428107 TTGTCCATCAAAAAGGATTCAGG + Intergenic
1180522797 22:16225569-16225591 TTGTCCATCACAAAGGACTCCGG - Intergenic
1182925406 22:34118599-34118621 TTGTCAATTAAAAAGGATGGAGG - Intergenic
949317661 3:2774469-2774491 GTGTGCATCAAAATGAAGGAGGG + Intronic
950797542 3:15522238-15522260 TCATCCAATAAAAAGGAGGAAGG + Intergenic
951641146 3:24836951-24836973 ATGTCCATCAATAAACAGGAAGG + Intergenic
951664154 3:25103381-25103403 TTAACCATGAAAGAGGAGGAAGG - Intergenic
955568019 3:60270637-60270659 TTTTCCAGCAAAAATGAGGTAGG + Intronic
956259365 3:67321218-67321240 TGGACCATCAGAAAGGAAGAGGG - Intergenic
956882413 3:73524181-73524203 TTGACTATTAAAAAGGATGATGG - Intronic
957129730 3:76207735-76207757 ATGTGGATCACAAAGGAGGAAGG + Intronic
957456029 3:80447101-80447123 TTTTCTATCAAAAAGTAGGATGG + Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
960165595 3:114397813-114397835 TGTTCCATTAAAAAGGGGGATGG - Intronic
960602015 3:119468321-119468343 TTTTCCAACAAATAGGAGAAGGG - Intronic
960687450 3:120308050-120308072 TTGCCCAGCAACATGGAGGATGG + Intergenic
962097137 3:132303743-132303765 TTGGCCATCAGAAAGAAGGCTGG + Intergenic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
963952170 3:151214622-151214644 TTGCCCAAAAAAAAGGAAGAAGG - Intronic
965237327 3:166142179-166142201 TTTTCCATCAAGAAGTTGGAAGG + Intergenic
966051111 3:175618639-175618661 GTGTCACTCCAAAAGGAGGAAGG - Intronic
966636064 3:182135036-182135058 CTGTCCATAAAAAAGTAGCATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967786947 3:193507520-193507542 TTGTCCAAAAAAAAAGAGGAGGG + Intronic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
974095416 4:57358620-57358642 TAGTACATAAAAAAGGGGGAGGG + Intergenic
975908144 4:79240046-79240068 TCTTCCATCATAAAGGGGGAAGG + Intronic
976766541 4:88603827-88603849 TTCTACAACAGAAAGGAGGAGGG - Intronic
978185369 4:105850890-105850912 TAATCCATCAAAGAGAAGGAAGG + Intronic
978592929 4:110345866-110345888 TTCTCCACCAAAAACTAGGAGGG - Intergenic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
979226911 4:118296622-118296644 TTTTCTATCTAAGAGGAGGAGGG + Intronic
979392685 4:120144914-120144936 GTGTCCATCAAAAAGGACAAAGG - Intergenic
979858999 4:125670166-125670188 TTCTAAATCAAAAAGGATGAGGG + Intergenic
981146041 4:141325339-141325361 TTGTCCTTTAAAAAATAGGATGG - Intergenic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
985015705 4:185632299-185632321 TTTTCTGTCTAAAAGGAGGATGG - Intronic
985250984 4:188024180-188024202 TTGTGAATCAAAAAGAAGCAAGG + Intergenic
985340222 4:188943514-188943536 TTTTCTATCATAAAGGAAGAAGG - Intergenic
986310366 5:6546669-6546691 TTCTCAATCAAGAAGCAGGATGG - Intergenic
986515004 5:8551974-8551996 TTGTGTTTCAAAAAGGAGAAGGG - Intergenic
987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG + Intronic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
989416799 5:41187557-41187579 TTTTCTATCAAAGAGGAGCAAGG + Intronic
991006524 5:61833200-61833222 TTTTCCCTAAAAAAGAAGGAAGG + Intergenic
991253760 5:64592728-64592750 TTGGGCATCACAGAGGAGGAGGG - Intronic
993006797 5:82437192-82437214 TTACCCACCAAAAAGGAAGAAGG - Intergenic
993574781 5:89587396-89587418 TTGTAAATCAAAAGGGAAGAAGG - Intergenic
994185521 5:96810905-96810927 TTTTACATCAAAAAGGAGAGTGG - Intergenic
994720500 5:103374282-103374304 TTTTCCACCCAAAGGGAGGATGG + Intergenic
995986133 5:118176517-118176539 AAGTCCACCAAAAAGGAAGAAGG + Intergenic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
999619316 5:153456478-153456500 TTGGCTAGCAAAATGGAGGAAGG - Intergenic
1000795698 5:165661772-165661794 GTGTCCTTAAAAAAGGAAGAGGG - Intergenic
1000956899 5:167554147-167554169 TTGTCCATAAAATTGGAGGGCGG - Intronic
1003461818 6:6335961-6335983 TTGTCCTTTAAAAAGATGGAAGG + Intergenic
1004337753 6:14779906-14779928 CTTTCCATCAAACAGAAGGAAGG + Intergenic
1004991367 6:21142034-21142056 TTTTCCAAAAAAAAGAAGGAAGG + Intronic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1009197201 6:60701473-60701495 TTCTCCATCCAAAAGAGGGAGGG + Intergenic
1009335254 6:62480390-62480412 TTGTCCTTCAAGAAAGAGGATGG + Intergenic
1012814418 6:104004034-104004056 TATTCCTTCAAAAAGGTGGAGGG + Intergenic
1013133840 6:107260961-107260983 ATGTCCATGAAAATGGAGGGGGG - Intronic
1014001001 6:116366261-116366283 GTGTCCATCAAATAAGAGCAAGG - Intronic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1015077428 6:129176971-129176993 TAGTCCATCAGAAAGAAGAAAGG - Intronic
1015338686 6:132072227-132072249 TTGTCCATCAACAAATAGAATGG - Intergenic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1018885778 6:167935184-167935206 CTTTCCATTAAAAAGGAAGAAGG - Intronic
1019860850 7:3657077-3657099 TTCTCCCCCACAAAGGAGGAGGG + Intronic
1022108536 7:27213734-27213756 TTGGCCATCATAGAGGAGGGAGG - Intergenic
1022123663 7:27334975-27334997 TTGCCCAGCTAAAAGGAGTAAGG + Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023813464 7:43930251-43930273 CAGTCCTTCAGAAAGGAGGAAGG + Intronic
1026580016 7:71607841-71607863 TTAACCATCAAGAAGGAAGAAGG - Intronic
1027533094 7:79360421-79360443 TAGAACATCAAAAAGGAAGAAGG + Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1032495247 7:132356602-132356624 TTGTCCACCAAAACAGAGTAAGG + Intronic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033685047 7:143631522-143631544 TTCACCAACAAAAAGGAGAAAGG + Intronic
1033688220 7:143710741-143710763 TTCACCAACAAAAAGGAGAAAGG + Intronic
1033699566 7:143826099-143826121 TTCACCAACAAAAAGGAGAAAGG - Intergenic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1036434519 8:8720989-8721011 TTGTCCATAAAAATACAGGATGG - Intergenic
1036740504 8:11357098-11357120 ATGTCCATCAAACTGGAGGTAGG - Intergenic
1037982415 8:23263593-23263615 TAGGCCATCAGAAAAGAGGAGGG + Intergenic
1038641576 8:29333360-29333382 TTGTCCATCAATAAAGATGGAGG - Exonic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1040817586 8:51525509-51525531 TTGTTTACCAAAACGGAGGAGGG - Intronic
1041322508 8:56628388-56628410 CTATCCATTGAAAAGGAGGAAGG - Intergenic
1043587162 8:81782628-81782650 TAGACCAAAAAAAAGGAGGAGGG - Intergenic
1044210789 8:89548169-89548191 CTACCCATCAAAAAGGAGTAAGG + Intergenic
1044300124 8:90573913-90573935 TTTGCCATCTAAAAGGAAGAAGG - Intergenic
1045167328 8:99621291-99621313 TTCTCCATAAATAAGGATGAAGG + Intronic
1045611232 8:103845249-103845271 ATGCCCATAAAAAAGGAGTATGG - Intronic
1045964152 8:108004155-108004177 TGATCCATCAAAAAGGATAATGG + Intronic
1046551288 8:115720460-115720482 TCATCCCTCAAAAAAGAGGAAGG + Intronic
1047389386 8:124437810-124437832 TTTTCTATCAACCAGGAGGAAGG + Intergenic
1049593896 8:143474716-143474738 TTGTCCATCAAAAAAAAAGAGGG - Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051838528 9:21367841-21367863 CTGTCCATCAGACAGGAGGAAGG + Exonic
1051844890 9:21440652-21440674 CTGTCCATCAGACAGGAGGAAGG - Exonic
1053700309 9:40683304-40683326 TTGTCCATCACAAAGGACTCCGG + Intergenic
1054311601 9:63482702-63482724 TTGTCCATCACAAAGGACTCCGG + Intergenic
1054410381 9:64806855-64806877 TTGTCCATCACAAAGGACTCCGG + Intergenic
1055184948 9:73440043-73440065 TTGTCCATAAAAGATGATGATGG + Intergenic
1056204894 9:84310315-84310337 TTGTCCATGAAAAAATGGGATGG - Intronic
1056951498 9:91043799-91043821 TTCTCCTGCAAAAAGGAGGCTGG - Intergenic
1058790194 9:108436630-108436652 TTTTTCATAAAAAAGGAGAAAGG + Intergenic
1059358540 9:113720184-113720206 TTGTCCTTCCAAAGGAAGGAAGG - Intergenic
1059369374 9:113813742-113813764 TTTTCCATTAAAAAGGATGCTGG - Intergenic
1059477795 9:114561731-114561753 TTATCCCACCAAAAGGAGGAGGG + Intergenic
1060239538 9:121890947-121890969 TTGTCTATCAGACAGCAGGAGGG - Intronic
1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG + Intergenic
1061432040 9:130537175-130537197 TTCTCCATCTAAAACCAGGAAGG - Intergenic
1061927982 9:133815688-133815710 ATGTCCATAAAGAAGGAAGATGG - Intronic
1185882682 X:3755412-3755434 TTGTCTTTCAAAAAGAAAGAAGG - Intergenic
1186062693 X:5727248-5727270 TTTACCATCAAAAGAGAGGATGG - Intergenic
1187296087 X:18002092-18002114 TTGTCTATCAGAAAAGAGCACGG + Intergenic
1187668165 X:21639102-21639124 TTGTCCACTACAAAGGAGAAGGG + Intronic
1189686002 X:43564218-43564240 TTGTCCATCAGAAGTGAGAAGGG + Intergenic
1192382237 X:70629554-70629576 TTGTCTTTCAAAAAGGAAAAGGG + Intronic
1196601364 X:117604976-117604998 TTGTCCATTAACAAAGAGGTTGG + Intergenic
1197090794 X:122534234-122534256 GTGTCCATCAAACAGAAGAATGG + Intergenic
1198141058 X:133804029-133804051 TTGTCCATTAAAAAAGGGGGGGG - Intronic
1200782292 Y:7227722-7227744 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200782314 Y:7227902-7227924 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic