ID: 1014541192

View in Genome Browser
Species Human (GRCh38)
Location 6:122678300-122678322
Sequence CTGAATGAAAAGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1159
Summary {0: 1, 1: 3, 2: 6, 3: 65, 4: 1084}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014541185_1014541192 -3 Left 1014541185 6:122678280-122678302 CCCAATTCCAGTTCTCTGTCCTG 0: 1
1: 1
2: 3
3: 31
4: 311
Right 1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG 0: 1
1: 3
2: 6
3: 65
4: 1084
1014541186_1014541192 -4 Left 1014541186 6:122678281-122678303 CCAATTCCAGTTCTCTGTCCTGA 0: 1
1: 0
2: 1
3: 37
4: 396
Right 1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG 0: 1
1: 3
2: 6
3: 65
4: 1084
1014541183_1014541192 28 Left 1014541183 6:122678249-122678271 CCAGCTCTATGAAAGTGAGAGCA 0: 1
1: 0
2: 0
3: 22
4: 1113
Right 1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG 0: 1
1: 3
2: 6
3: 65
4: 1084
1014541184_1014541192 1 Left 1014541184 6:122678276-122678298 CCTTCCCAATTCCAGTTCTCTGT 0: 1
1: 1
2: 3
3: 34
4: 400
Right 1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG 0: 1
1: 3
2: 6
3: 65
4: 1084
1014541187_1014541192 -10 Left 1014541187 6:122678287-122678309 CCAGTTCTCTGTCCTGAATGAAA 0: 1
1: 0
2: 2
3: 25
4: 284
Right 1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG 0: 1
1: 3
2: 6
3: 65
4: 1084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014541192 Original CRISPR CTGAATGAAAAGAGGCAGGA GGG Intronic
900361033 1:2289245-2289267 CTGACAGAGAGGAGGCAGGAGGG - Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901532743 1:9863760-9863782 GTGAAAGAACAGAGGCTGGAAGG + Intronic
901749933 1:11399870-11399892 CTGAATGAAGACAGGAAGGCTGG + Intergenic
901874796 1:12161376-12161398 CTGCAGGAAAGGATGCAGGATGG - Intergenic
901922187 1:12545264-12545286 ATGAATGAAGGGAGGAAGGAAGG - Intergenic
902199320 1:14822110-14822132 AGGAATGGAAAGAGGCAAGAAGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902554054 1:17236452-17236474 TTGAAGGAAAAGAGGCAGTTAGG + Intronic
902586120 1:17439403-17439425 AGGAATAAAAAGAGGAAGGAAGG - Intronic
902909039 1:19581516-19581538 GAGAATGAAAACAGGAAGGAAGG + Intergenic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
904127251 1:28249786-28249808 TTGAATGAAAAAAGGAAGGAAGG + Intergenic
905331853 1:37208823-37208845 ATGAATGAAATGAAGCAAGAAGG + Intergenic
906073508 1:43035115-43035137 CAGGAGGAAAATAGGCAGGAGGG + Intergenic
906249281 1:44299025-44299047 CTGACTGGGAAGAGGCACGAGGG + Intronic
906631910 1:47377787-47377809 CTGAATAAAAATAGCAAGGAAGG - Exonic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906822972 1:48948613-48948635 GTGAATCAAAAAAGGCAAGAGGG - Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906869272 1:49459020-49459042 AAGAAAGAAAAGAGGAAGGAAGG - Intronic
906909850 1:49936252-49936274 ATGAATGAAATGAAGCAAGAAGG + Intronic
906960422 1:50416480-50416502 TAGAAAGAAAAGAGGCAGGCGGG - Intergenic
907057708 1:51386734-51386756 ATGAATGAAATGAAGCAAGAAGG + Intronic
907139711 1:52175731-52175753 ATGAATGAAATGAAGCAAGAAGG - Intronic
907277300 1:53323946-53323968 CTGAATACCAAGAGGCTGGAAGG - Intronic
907581586 1:55577197-55577219 CTGGGTGATAAGCGGCAGGATGG - Intergenic
907623337 1:56004719-56004741 AGAAATGAAAAGAGGAAGGAAGG - Intergenic
907690298 1:56657746-56657768 ATGAATGAAAGAAGGAAGGAAGG + Intronic
907856916 1:58312651-58312673 CAGAATAAGAAGAGCCAGGAAGG + Intronic
907926504 1:58959534-58959556 ATGAATGAAATGAAGCAAGAAGG + Intergenic
907997964 1:59652479-59652501 ATGAATGAAATGAAGCAAGAAGG - Intronic
908269790 1:62411603-62411625 GAGAAAGAAAAGAGGAAGGAAGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908562969 1:65325215-65325237 CTGAATGAATAGATGCTTGAAGG - Intronic
908639202 1:66203574-66203596 ATGAATGAAACGAAGCAAGAAGG - Intronic
908765263 1:67548938-67548960 ATGAATGAAATGAAGCAAGAAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
908976941 1:69909997-69910019 ATGAATGAAATGAAGCAAGAAGG - Intronic
909061801 1:70887281-70887303 ATGCATGAAAAGTGCCAGGAAGG - Intronic
909767593 1:79376542-79376564 AGGAAGGAAAAGAGGAAGGAAGG + Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
910535693 1:88295114-88295136 CTGAAGGAAAGAAGGAAGGAAGG - Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
911492757 1:98589927-98589949 ATGAATGAAATGAAGCAAGAAGG + Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
911859785 1:102932818-102932840 ATGAATGAAATGAAGCAAGAAGG - Intronic
912916956 1:113825308-113825330 CTGAATTAAAAATGGCAAGATGG - Intronic
912951395 1:114123039-114123061 CTGGAAGCAAAAAGGCAGGAAGG - Intronic
913167372 1:116200511-116200533 AGGAATGAAAGGAGGAAGGAAGG - Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913704230 1:121402726-121402748 ATGAATGAAATGAAGCAAGAAGG + Intergenic
913719336 1:121575690-121575712 ATAAATGAAATGAAGCAGGAAGG + Intergenic
914401615 1:147326514-147326536 ATGAATGAAATGAAGCAAGAAGG - Intergenic
914960157 1:152197885-152197907 GAGAAAGAAAAGAGGAAGGAAGG - Intergenic
915654169 1:157345017-157345039 ATGAATGAAATGAAGCAAGAAGG - Intergenic
915875244 1:159605152-159605174 ATGAATGAAATGAAGCAAGAAGG + Intergenic
916020167 1:160784486-160784508 ATGAATGAAATGAAGCAAGAAGG + Intergenic
916238086 1:162610841-162610863 AGGAAGGAAAAGAGGGAGGAAGG + Intergenic
916381553 1:164217435-164217457 ATGAATGAAATGAAGCAAGAAGG + Intergenic
916543720 1:165782732-165782754 ATGAATGAAATGAAGCAAGAAGG - Intronic
916801352 1:168219589-168219611 CTGAATTCCAAAAGGCAGGAGGG + Intergenic
917152601 1:171960804-171960826 CTGGAAGAAAAAAAGCAGGATGG + Intronic
917397932 1:174614804-174614826 ATGAATGAAATGAAGCAAGAAGG - Intronic
917684830 1:177405645-177405667 ATGAATGAAATGAAGCAAGAAGG - Intergenic
917699419 1:177565004-177565026 ATGAATGAAATGAAGCAAGAAGG + Intergenic
918045996 1:180941341-180941363 CAGAATGAAAAGTGAAAGGAGGG + Intronic
918445032 1:184609022-184609044 CTGAAAGCAAAGAGAAAGGAAGG + Intronic
918468607 1:184846889-184846911 ATGAATGAAATGAGGCGAGAAGG + Intronic
919440239 1:197624932-197624954 ATGAATGAAATGAAGCAAGAAGG + Intronic
919472777 1:197999484-197999506 TTGTATGAAAAAAGGCAGGATGG + Intergenic
919473477 1:198007533-198007555 CTGAATGAAACAAGGAAGTAAGG - Intergenic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
919599956 1:199610413-199610435 GTGAATAAAAGGAGGTAGGAGGG - Intergenic
920194759 1:204219554-204219576 CTGAATGAACAGAGCCCAGATGG - Exonic
920355160 1:205366587-205366609 CTGAAAGGAAAAAGGGAGGATGG - Intergenic
921200487 1:212800659-212800681 ATGAATGAAAGAAGGAAGGAGGG - Intronic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
921704040 1:218299684-218299706 CTAAATGTAAGGAGGCAAGATGG - Intronic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
922030951 1:221797648-221797670 ATGAATGAAGACAGGGAGGATGG + Intergenic
922200856 1:223400260-223400282 ATGAATGAAATGAAGCAAGAAGG - Intergenic
922206162 1:223448270-223448292 ATGAATGAAATGAAGCAAGAAGG + Intergenic
922349784 1:224725824-224725846 CTAAAGGAAAAGAAGTAGGAAGG - Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
922794983 1:228335425-228335447 GAGAATGAAAAGAGGAAGGAGGG - Intronic
922824364 1:228507091-228507113 ATGAATGAAATGAAGCAAGAAGG + Intergenic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923235743 1:232031278-232031300 AAGAAAGAAAAGAGGAAGGAAGG + Intronic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923407899 1:233680821-233680843 CTGAATGAAAAAATTCAGAATGG - Intergenic
923823381 1:237472718-237472740 ATAAATGAAAAGAGGAAAGAAGG + Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924005156 1:239600812-239600834 GTGAAAGTAAAGAGGAAGGAAGG - Intronic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924632311 1:245752548-245752570 CTGGAAGAAAAGAGCGAGGAAGG - Intronic
924860774 1:247919566-247919588 GTGAAAGAAATGAGTCAGGAGGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064010958 10:11736167-11736189 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1064761806 10:18628670-18628692 CTGAATGAAATGAAGCAAGAAGG + Intronic
1064817991 10:19288695-19288717 CAGAATGAGAGGAGGAAGGATGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066544916 10:36489408-36489430 CTTATTTAAAAGAGGAAGGAAGG - Intergenic
1066664318 10:37767039-37767061 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1066813475 10:39371842-39371864 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1067830108 10:49606870-49606892 TTGAATGAGTAGAGGAAGGAAGG - Intergenic
1068006223 10:51394512-51394534 CTGGATTTTAAGAGGCAGGAGGG + Intronic
1068256353 10:54516475-54516497 ATGAATGAAATGAAGCAAGAAGG + Intronic
1069079468 10:64072739-64072761 CTGTTTGAAAAACGGCAGGAAGG - Intergenic
1069187561 10:65444538-65444560 CTGAATGAAATTAGGGAGGTGGG - Intergenic
1069284203 10:66692377-66692399 ATGAATGAAATGAAGCAAGAAGG + Intronic
1069637358 10:69933380-69933402 CTGAGTGAGAATAGTCAGGATGG + Intronic
1069656308 10:70091870-70091892 CCCAGAGAAAAGAGGCAGGAAGG + Exonic
1070171816 10:73938631-73938653 CTGAATTCCAAAAGGCAGGAGGG - Intergenic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1070505457 10:77108865-77108887 CTGAAGAAAAATAGGCAAGAGGG + Intronic
1070721855 10:78762512-78762534 ATGAAAGAAAAGAGGGAGGGGGG - Intergenic
1070760235 10:79019682-79019704 TTGAATGAAAAGAGGGTGGATGG + Intergenic
1070990371 10:80727241-80727263 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071247943 10:83785786-83785808 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071352534 10:84761590-84761612 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071354247 10:84777962-84777984 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072013837 10:91326579-91326601 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1072235696 10:93451548-93451570 GTGAAAGGAAAGAGGCAGTAAGG + Intronic
1072445881 10:95498114-95498136 CTGAATGCTAACAGGCAGAAAGG + Intronic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1072855197 10:98938504-98938526 ATGAATGAAATGAAGCAAGAAGG + Intronic
1072992119 10:100206528-100206550 TTGACTGAAAAGAGACATGAGGG + Intronic
1073199629 10:101724842-101724864 TGGAAGCAAAAGAGGCAGGAAGG - Intergenic
1073443433 10:103566344-103566366 TTGACTACAAAGAGGCAGGAAGG - Intronic
1073975398 10:109095204-109095226 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1074056153 10:109924134-109924156 GTGAAAGAGAAGAGGCAGGGAGG - Intergenic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1074303323 10:112252313-112252335 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1074656855 10:115599957-115599979 GTGAATGAAAAGGGTCATGAGGG - Intronic
1074730753 10:116372440-116372462 CTGAGTATAAATAGGCAGGAGGG - Intronic
1074903159 10:117837613-117837635 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1075271872 10:121059462-121059484 CTGAATTACAAGATGGAGGAGGG + Intergenic
1075563166 10:123483045-123483067 CTGAATCAAAGGAAGCAGAAAGG - Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1075678333 10:124313409-124313431 GAGGAGGAAAAGAGGCAGGAAGG + Intergenic
1075836100 10:125454305-125454327 CTCAAAGAACAGGGGCAGGACGG - Intergenic
1075918312 10:126188873-126188895 ATGAATGAAAGGATGAAGGATGG - Intronic
1076436596 10:130450260-130450282 CCCAAGGAAAAGAGGCAGAATGG - Intergenic
1076669653 10:132112451-132112473 CCGAAAGAACAGAGGCGGGATGG - Intronic
1076817225 10:132920897-132920919 ATGAGTGAAAGGAGTCAGGAAGG + Intronic
1077384520 11:2262732-2262754 CTGGATCACAACAGGCAGGACGG + Intergenic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1077893884 11:6439633-6439655 GAGAGAGAAAAGAGGCAGGAGGG + Intronic
1078304929 11:10174426-10174448 GTGAATGAAATGAAGCAAGAAGG + Intronic
1078559349 11:12357043-12357065 AAGAAAGAAGAGAGGCAGGAGGG - Intronic
1078671606 11:13370639-13370661 CTGAGTGAAAGTAGGCAGCATGG - Intronic
1078682558 11:13491131-13491153 CTAGATGAAAAGAAGTAGGAGGG - Intergenic
1079384514 11:19966916-19966938 CGGAATGAAAAGAGAGAGAAAGG + Intronic
1079577397 11:22020724-22020746 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1079598794 11:22286048-22286070 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1079868714 11:25768096-25768118 AGGAAGGAAAAGAGGGAGGATGG + Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080047326 11:27822437-27822459 GGGAATAAAAAGAGGAAGGAAGG - Intergenic
1080180243 11:29416879-29416901 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1080310355 11:30883214-30883236 CTGAATGACAAGAGGAGAGAAGG + Intronic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1081039531 11:38193150-38193172 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081413282 11:42784861-42784883 AGGAAGGAAGAGAGGCAGGAAGG + Intergenic
1081576733 11:44323346-44323368 ATGAATGAAGAAAGGAAGGAAGG + Intergenic
1081938274 11:46919156-46919178 GTGAATGAAAAGGGGCGGGGGGG - Intergenic
1082150314 11:48730672-48730694 ATGAATGCAATGAAGCAGGAAGG + Intergenic
1082227600 11:49726564-49726586 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1082714064 11:56591394-56591416 TTGAATGAAATGAAGCAAGAAGG - Intergenic
1083039267 11:59669881-59669903 CTGAAAGGAAAGGGGCAAGAAGG - Intergenic
1084050325 11:66595275-66595297 CTGGATGGAAGGAGGCTGGAGGG + Intronic
1084375728 11:68776101-68776123 CTGAGTGAAAAGAAGCAGGCAGG + Intronic
1084729540 11:71064581-71064603 CTGGAAGGAAAGAGGCTGGATGG + Intronic
1085261638 11:75208857-75208879 CTGAATGAATGAAGGAAGGAAGG - Intergenic
1085331827 11:75658458-75658480 CTAAATGAAAGTAGGCAGAAAGG - Intronic
1085432887 11:76470653-76470675 CTACATGATAAGAGGCAAGAGGG - Intronic
1085642947 11:78204618-78204640 ATGAATGAATAGAGGCAAAAAGG - Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086378227 11:86223281-86223303 CTAAATGAAAAGAGTGAGGTAGG + Intergenic
1086481632 11:87246578-87246600 ATGAATGAAATGAAGCAAGAAGG - Intronic
1086520582 11:87663939-87663961 CTGAATGAAAGGAGGTGGGAAGG - Intergenic
1086789213 11:91014600-91014622 TTGAATGTAAAGAGGCATGCGGG + Intergenic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1087490156 11:98815196-98815218 CTGCATGACAAGAGTCATGAAGG + Intergenic
1088012278 11:105017571-105017593 GTGAATGAAATGAAGCAAGAAGG + Intronic
1088406646 11:109487981-109488003 GTGATTGAAAAGAAGCATGAAGG - Intergenic
1088468094 11:110163754-110163776 CTGGAAGACAAGAGGCAGGTAGG + Intronic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089220878 11:116870398-116870420 CTGCCTGAAGAGAGACAGGAAGG + Exonic
1089816080 11:121176901-121176923 ATGAATGAAATGAAGCAAGAAGG - Intronic
1089822310 11:121239757-121239779 CTGAATGAGAAGATGCAACAAGG + Intergenic
1089923277 11:122230680-122230702 TTGAATGAATATAGGAAGGAAGG - Intergenic
1090690442 11:129175207-129175229 ATGAATGAAATGAAGCAAGAAGG + Intronic
1090706606 11:129343640-129343662 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1091062861 11:132480284-132480306 ATGAATGAAATGAAGCAAGAAGG + Intronic
1091113525 11:132993520-132993542 ATGAATGACACCAGGCAGGAAGG + Intronic
1091494881 12:963946-963968 CTGAATGAAATGAGTGAGAAGGG + Intronic
1091889366 12:4040895-4040917 GACACTGAAAAGAGGCAGGAGGG + Intergenic
1091935821 12:4433738-4433760 ATGATTGGAAAGAGGCAGAATGG + Intronic
1091943307 12:4510160-4510182 ATGAATGAAATGAAGCAAGAAGG + Intronic
1092037744 12:5353719-5353741 AAGAAAGAAAAGAGGAAGGAAGG + Intergenic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1093332211 12:17856819-17856841 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1093493811 12:19733411-19733433 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1093552496 12:20431206-20431228 CAGAATGAAATGAGGCTGTAGGG + Intronic
1094057560 12:26282464-26282486 CTGAAGTAAAAGAGGATGGATGG - Intronic
1094083643 12:26565428-26565450 ATGAATGAAAATAGGAAGGAAGG + Intronic
1094123831 12:27001621-27001643 TTGAAGGAAAAGAGAGAGGATGG - Intronic
1094390691 12:29947052-29947074 ATGAATGAAATGAGGAAGGAAGG + Intergenic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1095059445 12:37665316-37665338 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1095065165 12:37763108-37763130 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1095151485 12:38800922-38800944 ATGAATGAAATGAAGCAAGAAGG + Intronic
1095340733 12:41086184-41086206 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1095398238 12:41785770-41785792 AAGAATTAAAAGAGGCAAGAGGG - Intergenic
1095466557 12:42493651-42493673 CTGAATGATGATAGGCAAGAAGG - Intronic
1095591416 12:43907761-43907783 ATGAATGAAATGAAGCAAGAAGG + Intronic
1095911244 12:47428178-47428200 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1095969434 12:47891731-47891753 CTGGATGAGAAGGGACAGGAAGG - Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1096901467 12:54887608-54887630 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1096962249 12:55591215-55591237 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1097259524 12:57709097-57709119 CTGAAAGAAAAGAGTAAAGAAGG - Intronic
1097304897 12:58058396-58058418 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097452463 12:59752520-59752542 ATGAATGAAATGAAGCAAGAAGG + Intronic
1097558530 12:61171353-61171375 AGGAAGGAAAAGAGGAAGGAAGG + Intergenic
1097621344 12:61942718-61942740 ATGAATGAAATGAAGCAAGAAGG + Intronic
1098057446 12:66522944-66522966 ATGAATGAAATGAAGCAAGAAGG + Intronic
1098601336 12:72334874-72334896 AGGAATGAAAAGAGTCAGGCAGG + Intronic
1098668762 12:73198363-73198385 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1098831110 12:75364186-75364208 CTGAATTACAAAAGGGAGGAAGG + Intronic
1099079658 12:78160899-78160921 AGGATAGAAAAGAGGCAGGAAGG - Intronic
1099267261 12:80463282-80463304 ATGAATGAAATGAAGCAAGAAGG + Intronic
1099432561 12:82605214-82605236 TTGAAAGGAAAGAGGCAGTAAGG - Intergenic
1099750390 12:86765281-86765303 ATGAATGAAATGAAGCAAGAAGG + Intronic
1099773892 12:87099681-87099703 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1100011976 12:89964601-89964623 ATAAATGAAAAAAGGCAAGAAGG - Intergenic
1100095220 12:91025748-91025770 AAGAATGAAAAGATGCAGAATGG + Intergenic
1100174291 12:92011904-92011926 AAGAATGAAAGAAGGCAGGAAGG + Intronic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100202633 12:92315270-92315292 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1100745149 12:97637422-97637444 AAGAATGAAAAGAAGAAGGAAGG - Intergenic
1100855415 12:98753291-98753313 CTGACCCAAAAGAGGCAGGGTGG + Intronic
1100882613 12:99035408-99035430 CTGAGTGAAGAAAGCCAGGAAGG - Intronic
1101389325 12:104286175-104286197 CTGAATGAAGGAAGGAAGGAAGG - Intronic
1101414794 12:104499693-104499715 AAGAAGGAAAAAAGGCAGGAAGG + Intronic
1101629156 12:106476593-106476615 ATGAATGAAATGAAGCAAGAAGG - Intronic
1102144986 12:110648330-110648352 CAAAAGGAAAAAAGGCAGGAAGG - Intronic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102480963 12:113222707-113222729 CTAAAAAAAAAGAGGCAGGGGGG - Intronic
1103352653 12:120295722-120295744 CTGAAGGAAAACAGGCAGTGAGG - Intergenic
1103516771 12:121513403-121513425 CTGAAAGCAAAGACGCAGGCAGG + Intronic
1103546993 12:121709240-121709262 CTGAAAGAAAGAAGGAAGGAAGG - Intergenic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1105598233 13:21860481-21860503 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1105667476 13:22576012-22576034 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1105936654 13:25106714-25106736 TTGACTGGAAAGAGGCAAGAAGG + Intergenic
1106082925 13:26515464-26515486 CTGAAGTTAAAGAGGCACGAGGG + Intergenic
1106110038 13:26768897-26768919 CTGAATGAAATGGGAGAGGAAGG + Intergenic
1107402147 13:40079982-40080004 CTGAATGAAAACATGCAGTGGGG + Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1107814096 13:44228848-44228870 GTGAAGTAAAAGAGGCTGGAAGG - Intergenic
1108034912 13:46280500-46280522 TTGAATGGAAAGATGCAGAAAGG - Intergenic
1108137316 13:47379529-47379551 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1108388714 13:49926268-49926290 ATGAATGAAATGAGATAGGAAGG + Intronic
1108491205 13:50983334-50983356 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1108607601 13:52055214-52055236 ATGAATGAAATGAAGCAAGAAGG + Intronic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109018548 13:57053279-57053301 ATGACTGGAAAGAGACAGGAGGG + Intergenic
1109033331 13:57222160-57222182 CTGAAGGGAATGAGACAGGAAGG + Intergenic
1109184834 13:59255658-59255680 TTGAATGAAAAAAAGAAGGAAGG + Intergenic
1109718493 13:66247071-66247093 CAGAAGGCAAAGAGGAAGGAAGG - Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110430664 13:75419285-75419307 TGGAATGAGAAGAGGCAGAACGG - Intronic
1110459734 13:75732351-75732373 ATGAATGAAATGAAGCAAGAAGG - Intronic
1110656005 13:78000512-78000534 CTCAATTAAAAGATGCAGAATGG + Intergenic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1110996020 13:82110914-82110936 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1111462836 13:88568567-88568589 CTGTATAAAAACAGGCATGAAGG + Intergenic
1111723204 13:91973193-91973215 ATGAATGAAATGAAGCAAGAAGG - Intronic
1111767712 13:92554279-92554301 CTGAATGAAAAGACAGAGGGTGG - Intronic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112239947 13:97672141-97672163 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1112272141 13:97977307-97977329 CTAAATGGAAAAAGGCAGTAGGG - Intronic
1112564911 13:100544896-100544918 CTCTATGCAAACAGGCAGGATGG + Intronic
1112745595 13:102523428-102523450 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1112870857 13:103969038-103969060 CCAAATGAAAGGAAGCAGGAGGG + Intergenic
1113001606 13:105644895-105644917 CTGAAAGAAAAAAGGAAGGAAGG - Intergenic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1113243332 13:108364965-108364987 AAGTATGAAAAGAGACAGGATGG - Intergenic
1113668990 13:112162984-112163006 CAGACTCAAAAGATGCAGGATGG + Intergenic
1113742830 13:112723294-112723316 CTGAATGACAAGAGGGCGGGGGG - Intronic
1114156111 14:20105058-20105080 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1114509679 14:23248099-23248121 CTAAATAAAAAGAGGCTTGAAGG - Intronic
1114745768 14:25145024-25145046 TTGACTGGAAAGGGGCAGGAGGG - Intergenic
1114869069 14:26633999-26634021 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1114872743 14:26678046-26678068 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1114879703 14:26768947-26768969 TGGAAAGAAAGGAGGCAGGAAGG - Intergenic
1115070015 14:29310231-29310253 CAGTATGAAAAGGGTCAGGAGGG - Intergenic
1115070337 14:29314755-29314777 AGGAAAGAAAAGAGGAAGGAAGG + Intergenic
1115078647 14:29422809-29422831 CTGAATAAAAAAAGAAAGGAAGG - Intergenic
1115419793 14:33181251-33181273 TGGAAGGAAAAGAGGAAGGAGGG + Intronic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1116306496 14:43263341-43263363 ATGAATGAAATGAAGCAAGACGG + Intergenic
1116455227 14:45112752-45112774 CTGAATGAGAGAAGGCAGGAAGG + Intronic
1116524441 14:45887957-45887979 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1116954550 14:50910774-50910796 CTGCAGGAAAAGTGGAAGGAAGG - Intronic
1117434607 14:55703954-55703976 TTGAAGGAAATCAGGCAGGAGGG - Intergenic
1117654866 14:57944632-57944654 AAAAAAGAAAAGAGGCAGGAAGG + Intronic
1117663670 14:58033818-58033840 ATGAATGAAATGAAGCAAGAAGG + Intronic
1117767380 14:59097116-59097138 ATGAATGAAAGGAGGAAAGAAGG - Intergenic
1118270263 14:64336873-64336895 CTGAATGAAGAGAGGAAGTTAGG - Intronic
1118916178 14:70108451-70108473 AAGAATGAAAAGAGGAAGGGAGG - Intronic
1119494247 14:75064797-75064819 CTGAATGAAAAAGGACAGAAAGG - Intronic
1119729097 14:76939874-76939896 CTGAAGGAAAAGTGAGAGGATGG + Intergenic
1120202439 14:81552626-81552648 TTGACTGGAAAGGGGCAGGAGGG + Intergenic
1120233062 14:81860166-81860188 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1120776954 14:88448211-88448233 ATGAATGAAATGAAGCGGGAAGG - Intronic
1120971421 14:90211506-90211528 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1120984347 14:90320647-90320669 AAGAAGGAAAAGAGGAAGGAAGG + Intronic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1123173635 14:106397959-106397981 GTGAGCGAAAAGAGGGAGGACGG - Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1124211936 15:27770829-27770851 AGGAAGGAAAAGAGGGAGGAAGG - Intronic
1125232122 15:37468303-37468325 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1125413592 15:39429945-39429967 CTCAAGGATAAGAGGTAGGAAGG - Intergenic
1125911796 15:43446591-43446613 CTGAAAGAAGTGAGGCAGGGAGG + Intronic
1126002216 15:44221556-44221578 CTGAACACAAAGGGGCAGGAAGG + Intergenic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126501954 15:49355505-49355527 ATGAATGAAATGAAGCAAGAAGG + Intronic
1126505266 15:49397262-49397284 ATGAATGAAATGAAGCAAGAAGG + Intronic
1126677635 15:51174255-51174277 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1126897532 15:53275033-53275055 AGGAATGAAAAAAGGAAGGAAGG - Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128180931 15:65603425-65603447 TTGACTCAAAAGAAGCAGGAGGG - Intronic
1128294644 15:66507373-66507395 CTGAATGAAAAGAGCATGGATGG - Intronic
1128574969 15:68767552-68767574 CTGATTGAAAAGAGGCATGAGGG - Intergenic
1128792977 15:70446759-70446781 GAGAAGGAAAAGGGGCAGGAAGG - Intergenic
1128853726 15:70989359-70989381 ATGAATGAAATGAAGCAAGAAGG - Intronic
1128942158 15:71797752-71797774 ATGAATGAAATGAAGCAAGAAGG - Intronic
1129085274 15:73083043-73083065 GTGAATGAAAACAGGAAAGACGG + Intronic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129621872 15:77155211-77155233 ATGAATGAAATGAGGCGAGAAGG - Intronic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1129837605 15:78721109-78721131 ATGAATGAAATGAAGCAAGAAGG + Intronic
1130135656 15:81179694-81179716 CTGACTTTAAAGATGCAGGAAGG - Intronic
1130633663 15:85595978-85596000 ATGAAATGAAAGAGGCAGGAAGG - Intronic
1130667287 15:85880342-85880364 GTGAAGGAAATGAGGAAGGAAGG + Intergenic
1130902724 15:88219217-88219239 ATCAATGAAAAAAGACAGGAGGG + Intronic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1131298522 15:91173576-91173598 TTGAAGGCAAAGAGGCAGGCTGG - Intronic
1131331339 15:91501899-91501921 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1131584320 15:93676678-93676700 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1131928954 15:97418037-97418059 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1131993672 15:98114066-98114088 CAGAATGAGAAGTGTCAGGATGG + Intergenic
1132710260 16:1263211-1263233 CTGGCTGGAAAGAGCCAGGAGGG + Intergenic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1133388029 16:5386522-5386544 CTGAATGCAAAGAGTAGGGAGGG - Intergenic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1134675821 16:16089963-16089985 CTGAATGACAAGAGGTAGGGAGG - Intronic
1134764975 16:16749764-16749786 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135224107 16:20640619-20640641 CTGAATGCACAGAGCCAGGGTGG - Intronic
1135640251 16:24113556-24113578 AAGAATGAAAAGAGAGAGGAAGG - Intronic
1136678608 16:31938955-31938977 ATGAATGAAATGAAGCGGGAAGG + Intergenic
1136771023 16:32841409-32841431 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1136899549 16:34020073-34020095 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1136983145 16:35076188-35076210 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1137404011 16:48176044-48176066 CTGAATGAATATAGGCAGTAGGG + Intronic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1138435100 16:56994184-56994206 CTGAAAGAAAAGGGGGTGGAGGG + Intronic
1138842297 16:60524037-60524059 ATGAATGAAATGAAGCGGGAAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139346312 16:66306168-66306190 GTGAATGAGAAGAGGCAGGTTGG + Intergenic
1140173206 16:72628552-72628574 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140622404 16:76751436-76751458 CAGAAGGAGAAGGGGCAGGAGGG + Intergenic
1141232923 16:82187233-82187255 CAGAAGGAAGAGAGACAGGAGGG - Intergenic
1141239757 16:82254599-82254621 CTGAATGAAACTGGGCAGGGAGG - Intergenic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1203073446 16_KI270728v1_random:1103522-1103544 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1143233953 17:5381890-5381912 TTGAAAGAAAGGAGTCAGGAGGG - Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143325058 17:6093284-6093306 CTGAATGAGATAAAGCAGGAAGG - Intronic
1143761866 17:9110572-9110594 TAGATAGAAAAGAGGCAGGAGGG - Intronic
1143888920 17:10087521-10087543 ATGAATGAAGAAAGGAAGGAAGG + Intronic
1144203810 17:12964983-12965005 AAGAAAGAAAAGAGGCAGTAGGG - Intronic
1144251795 17:13424220-13424242 TTTAATGAAAAAAGGCAGGGTGG + Intergenic
1145718265 17:27044389-27044411 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1145785097 17:27588452-27588474 CTGCAGGGAAAGAGGCCGGATGG - Intronic
1146511538 17:33453441-33453463 CTTTTTGAAAAGAGGCAGGGAGG + Intronic
1146728556 17:35174880-35174902 CGGAAGGAAAAAAGGAAGGAGGG + Intronic
1147610202 17:41797531-41797553 ATGAATGAAGGGAGGCAGGGGGG - Intergenic
1148207609 17:45789158-45789180 CTCAGTGAAAAGAGGGAGTAGGG + Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150281002 17:63929603-63929625 CTGAATGAAGGAAGGAAGGAAGG + Intronic
1150727936 17:67666652-67666674 GAGATTGAGAAGAGGCAGGAGGG + Intronic
1151157907 17:72139744-72139766 AGAAATGAAAAGAGGAAGGAAGG + Intergenic
1151288809 17:73133580-73133602 CTGATGGAGAAGAGGCTGGAGGG - Intergenic
1151323982 17:73367804-73367826 TTGAATGAGAAGAGGCCGGCAGG - Intronic
1151462562 17:74263273-74263295 ATGAATGAAAAGGGGAAGAAAGG - Intergenic
1152446473 17:80347611-80347633 CTGCATGGAAACAGGCAAGATGG + Exonic
1152500234 17:80703374-80703396 GTGCATGAAAAGAGGCTGGCAGG + Intronic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153239186 18:3015253-3015275 CTGAATGATGAAAGGAAGGAAGG - Intergenic
1153430007 18:5005408-5005430 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1155931912 18:31717359-31717381 TTGACTGAAAAGAGGCACAAGGG + Intergenic
1156344006 18:36239861-36239883 ATGAATGAAATGAAGCAAGAAGG - Intronic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157330348 18:46699677-46699699 GTGAAAGAAAAGAGGGAGAAAGG - Intronic
1157429383 18:47612153-47612175 CAGAAAGATTAGAGGCAGGAAGG - Intergenic
1157574371 18:48733767-48733789 CTGAGTGTGAAGAGCCAGGAGGG - Intronic
1157738981 18:50075276-50075298 TTCACAGAAAAGAGGCAGGATGG + Intronic
1157933614 18:51850192-51850214 TTGACTGCAAAGAGGCATGAGGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158074522 18:53512726-53512748 ATGAATGAAATGAAGCAAGAAGG + Intronic
1158177026 18:54668906-54668928 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1159979230 18:74755864-74755886 AGGAAGGAAAAGAGGAAGGAAGG - Intronic
1161201837 19:3019464-3019486 CTGCTAGAAAGGAGGCAGGATGG + Intronic
1163110885 19:15160597-15160619 GAGAAAGAAAGGAGGCAGGACGG + Exonic
1163468622 19:17484137-17484159 CTGAATGAATGAAGGAAGGAGGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164246498 19:23434858-23434880 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1164333521 19:24284500-24284522 ATGAATGAAATGAAGCATGAAGG - Intergenic
1164430009 19:28178858-28178880 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1164978273 19:32592218-32592240 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1165563489 19:36702651-36702673 ATGAATGAAATGAAGCAAGAAGG - Intronic
1165854364 19:38870856-38870878 TTGAAGGAAAGGAGGAAGGAAGG - Exonic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166617619 19:44265079-44265101 CTGACTTGAAAGAGACAGGAGGG - Intronic
1166899333 19:46046440-46046462 CTGAATTAAAAGACACAGAATGG + Intronic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1202658620 1_KI270708v1_random:48255-48277 ATGAATGAAATGAAGCAAGAAGG - Intergenic
926033546 2:9614843-9614865 CTGATAGACTAGAGGCAGGAAGG - Intronic
926824057 2:16884689-16884711 AAGAATGAAAAAAGGAAGGAAGG - Intergenic
928148893 2:28808759-28808781 TCAAATGAAAAGAGGCAAGAAGG + Intronic
928463488 2:31497709-31497731 ATGAATGAAATGAAGCAAGAAGG + Intergenic
928682063 2:33712765-33712787 CTGAATTCCAAGAGGTAGGAGGG - Intergenic
928921374 2:36531750-36531772 TTGAGGGAAAATAGGCAGGAGGG + Intronic
928985985 2:37182136-37182158 TTCAATGGTAAGAGGCAGGAGGG - Intronic
929176133 2:38978339-38978361 CTGAAGGGAATGAGGCAAGAAGG - Intergenic
929566649 2:42990752-42990774 ATGAATGAAAAGAAGTAAGAAGG + Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930615432 2:53588301-53588323 ATGAATGAAATGAAGCAAGAAGG + Intronic
930830760 2:55741090-55741112 ATGAATGAAATGAAGCAAGAAGG - Intergenic
931030867 2:58173052-58173074 GTGAATGAAATGAAGCAAGAAGG + Intronic
931619304 2:64193810-64193832 CTGGATGCAAGGAGTCAGGAAGG - Intergenic
931977193 2:67655477-67655499 ATGAATGAAATGAAGCAAGAAGG + Intergenic
932393188 2:71416204-71416226 ATGAATGAAATGAAGCAAGAAGG - Intronic
932980002 2:76652722-76652744 ATGAATGAAATGAAGCAAGAAGG - Intergenic
933169547 2:79110418-79110440 ATGAATGAAATGAAGCAAGAAGG - Intergenic
933186672 2:79286982-79287004 ATGAATGAAATGAAGCAAGAAGG - Intronic
933879935 2:86659969-86659991 ATGAATGAAATGAAGCAAGAAGG - Intronic
934042588 2:88141010-88141032 AAGAAAGAAAAGAGGGAGGAGGG - Intergenic
934701221 2:96441858-96441880 ATGAATGAAAGGAAGCAAGAAGG + Intergenic
935047639 2:99496824-99496846 CTGATTGAAATGAATCAGGATGG - Intergenic
935278477 2:101496574-101496596 CTGGATGAAAGGGGGCAGGCAGG - Intergenic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
935616423 2:105087787-105087809 AGGAAGGAAAAAAGGCAGGAGGG - Intronic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
935960691 2:108423090-108423112 AAGAATGGAAGGAGGCAGGAAGG - Intergenic
936553876 2:113476216-113476238 ATGAATGAAATGAAGCAAGAAGG - Intronic
936576168 2:113657419-113657441 ATGAATGAAATGAAGCAAGAAGG + Intergenic
936621311 2:114101025-114101047 ATGAATGAAATGAAGCAAGAAGG - Intergenic
937155954 2:119719182-119719204 GTGATTGGAAAGGGGCAGGAGGG - Intergenic
937297313 2:120817557-120817579 CTGAGGGAAAAGGGGCAGGCAGG - Intronic
937676564 2:124597870-124597892 ATGAATGAAATGAAGCAAGAAGG - Intronic
937794550 2:126001437-126001459 CTGATTAAAAAGGGACAGGAAGG - Intergenic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
938520671 2:132067595-132067617 ATGAATGAAATGAAGCAAGAAGG - Intergenic
938748162 2:134301002-134301024 CTGAATGGAAAGAGGCATGGGGG - Intronic
938880981 2:135588067-135588089 GAGAAAGAAAAGAGGAAGGAGGG - Intronic
938892616 2:135721061-135721083 CTACATGAATAGAGACAGGATGG - Intronic
938992714 2:136645685-136645707 GTGAAAGGAAGGAGGCAGGAGGG + Intergenic
939060477 2:137415756-137415778 CTGAATGAAAGGAGAGATGAAGG - Intronic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939455349 2:142427208-142427230 CTGAATTAAAAGATGCAAGGTGG - Intergenic
939470274 2:142612512-142612534 GTGAATGAAATGAAGCAAGAAGG - Intergenic
939554999 2:143662830-143662852 ATGAATGAAATGAAGCAAGAAGG + Intronic
940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG + Intergenic
940253299 2:151703586-151703608 ATGAATGAAATGAAGCAAGAAGG - Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
941437248 2:165487210-165487232 ATGAATGAAATGAAGCAAGAAGG + Intronic
941626558 2:167836442-167836464 ATGAATGAAATGAAGCAAGAAGG + Intergenic
942056809 2:172191994-172192016 ATGAATGAAATGAAGCAAGAAGG - Intergenic
942214345 2:173704109-173704131 ATGAATGAAATGAAGCAAGAAGG - Intergenic
942277608 2:174334555-174334577 TTGTAGGAAAGGAGGCAGGAGGG - Intergenic
942396350 2:175553798-175553820 ATGAATGAAAAGTGGGAAGAAGG - Intergenic
942731511 2:179065904-179065926 ATGAATGAAATGAAGCAAGAAGG - Intergenic
942911617 2:181251274-181251296 CTGAATGAAGAGAGGAATGCAGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943097965 2:183453035-183453057 ATGAATGAAATGAAGCAAGAAGG - Intergenic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943581215 2:189685586-189685608 CTAAATGAAAACAAGCAGCAAGG - Intronic
943686227 2:190821218-190821240 CTGAAATGAAAGAGGAAGGAAGG - Intergenic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
943787536 2:191895255-191895277 CAGAAGGAAAAGACGAAGGAAGG + Intergenic
943921162 2:193709633-193709655 ATGAATGAAATGAAGCAAGAAGG - Intergenic
944247958 2:197551885-197551907 CTGATTGTAATGAGGCAGTAAGG + Exonic
944682483 2:202089776-202089798 CTGACTAAAAAGCGGCATGAGGG + Intronic
945209996 2:207372734-207372756 CTGAAAGAAAAGGGGTGGGAAGG + Intergenic
945352816 2:208802050-208802072 CTGAATGAAATGAAGCGAGAAGG + Intronic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946817547 2:223594390-223594412 GTGAGTGAAAAGGGGAAGGAAGG + Intergenic
947129648 2:226908326-226908348 CTGAATGAAATGAGAGAGGGAGG - Intronic
947465475 2:230341218-230341240 ATGAATGAAATGAAGCAAGAAGG - Intronic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
948903650 2:240967933-240967955 ATTAAAGGAAAGAGGCAGGAGGG + Intronic
1168868601 20:1109830-1109852 ATGAGTGAAAAAAGGCATGAAGG + Intergenic
1169561894 20:6810523-6810545 CTGACTGAAAATGGGCATGAGGG + Intergenic
1169575686 20:6958200-6958222 CTGACTGAAAAGAAGTAGAAAGG - Intergenic
1169689588 20:8315667-8315689 CTTAATGAAAGTAGGCAGTAAGG - Intronic
1169748049 20:8963325-8963347 CTGAATGAGAAGAGTCAGCCAGG + Intronic
1169789551 20:9395122-9395144 CTGATAGAAAATAGGCAGGTTGG - Intronic
1170264536 20:14450789-14450811 CTGAAGGAAAAGGGGCTAGAAGG + Intronic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170514931 20:17119512-17119534 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1170542064 20:17399140-17399162 CAAAATGACAAGTGGCAGGATGG + Intronic
1170905373 20:20511370-20511392 CTGATTGAAAAGCGGCAAAATGG - Intronic
1170910443 20:20561399-20561421 ATGTATGAAAGGAGGCAGGAAGG - Intronic
1171892900 20:30732514-30732536 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1171901801 20:30865390-30865412 ATGAAGGAAGAGAGGAAGGAAGG + Intergenic
1172288587 20:33758693-33758715 CTGAAAGACAAGTGGAAGGAGGG - Intronic
1173156903 20:40620609-40620631 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1173183222 20:40820209-40820231 CTGGACGAAAGGAGGCAGGTAGG - Intergenic
1173194440 20:40902733-40902755 CAGAATTAAAAGAAACAGGAGGG + Intergenic
1173639585 20:44591346-44591368 CTGAATGGAAAGTCGCTGGAGGG + Intronic
1173662654 20:44745332-44745354 CTGAATGAAAGAAGGAAGGAAGG + Intergenic
1173920179 20:46738531-46738553 ATGAATGAAACAAGGAAGGAAGG + Intergenic
1174257748 20:49270877-49270899 CTGCAGGAAAAGAGGCGAGAGGG - Exonic
1174928181 20:54783786-54783808 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1174966763 20:55225048-55225070 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1175026130 20:55904971-55904993 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1175380946 20:58563613-58563635 CTGATTAAAAAGGGGCATGAAGG + Intergenic
1175411881 20:58775901-58775923 GTCAATGGAGAGAGGCAGGATGG - Intergenic
1175529212 20:59662679-59662701 CTGGAGGAAAAGGGGCTGGAGGG + Intronic
1175605780 20:60311259-60311281 CTGAATGAAAGAAGGAGGGAGGG - Intergenic
1175667722 20:60874302-60874324 CTGAAAGGGAGGAGGCAGGATGG + Intergenic
1176423433 21:6533501-6533523 CTGAATGACAGGTGACAGGACGG - Intergenic
1176598644 21:8772164-8772186 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1176941263 21:14928361-14928383 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1177660993 21:24084285-24084307 CTTAATGGAAAGAGGGAGGCAGG - Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178740326 21:35194025-35194047 CGGAAGGCAAAGAGGAAGGAAGG + Intronic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179192639 21:39136585-39136607 GTGGATGAGAAGTGGCAGGAAGG - Intergenic
1179292069 21:40027603-40027625 ATGAATGAAATGAAGCAAGAAGG - Intronic
1179292969 21:40034429-40034451 ATGAATGAAATGAAGCAAGAAGG + Intronic
1179438390 21:41377383-41377405 CTGAAAGAAAAGCTCCAGGAAGG - Intronic
1179482411 21:41686546-41686568 GTGAATGGAAAAAGGGAGGAAGG + Intergenic
1179544316 21:42104291-42104313 CTGAGTGAAATGGGGCTGGAAGG + Intronic
1179698927 21:43141817-43141839 CTGAATGACAGGTGACAGGACGG - Intergenic
1179912258 21:44456475-44456497 CTGAAAGGGAAGACGCAGGAGGG - Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181686735 22:24534351-24534373 CTGAATGAAGAGGTGTAGGAAGG - Intergenic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1181996652 22:26888151-26888173 CTGAATAAAAAGAAGCTGGCTGG + Intergenic
1182070102 22:27457515-27457537 CTCAGTGAATAGAGGCAGGGTGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182184845 22:28391568-28391590 GTGAATGAAATGAAGCAAGAAGG - Intronic
1182377743 22:29860424-29860446 AGGAAGGAAAAGAGGGAGGAAGG - Intergenic
1182525647 22:30916675-30916697 AAGAAGGAAAGGAGGCAGGAAGG + Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183091108 22:35522821-35522843 GAGAAAGAAAAGAGGAAGGAAGG - Intergenic
1183214939 22:36473533-36473555 CAGAAAGAAAAGAGGAAGGAAGG + Intronic
1183334335 22:37237989-37238011 CTGAATGACAGGAAGCAGGGAGG + Intronic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1183870717 22:40739963-40739985 CAGAACCAAATGAGGCAGGAAGG - Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
949201823 3:1388828-1388850 ATGAATGAAATGAAGCAAGAAGG + Intronic
949425389 3:3910198-3910220 ATGAATGAAATGAAGCAAGAAGG + Intronic
949610776 3:5701240-5701262 GTGATTGAAATGAGTCAGGATGG + Intergenic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950254186 3:11491198-11491220 ATGAATGAAATGAAGCAAGAAGG - Intronic
950285215 3:11739441-11739463 CTCACTGTAAGGAGGCAGGAGGG - Intergenic
950648276 3:14391465-14391487 CTTACTGACAAGATGCAGGACGG - Intergenic
950705366 3:14776218-14776240 CTGAAACACAAGAGGAAGGAGGG + Intergenic
951175563 3:19594986-19595008 ATGAATGAAATGAAGCAAGAAGG - Intergenic
951247525 3:20358477-20358499 ATGAATGAAATGAAGCAAGAAGG - Intergenic
951321792 3:21254455-21254477 ATGAATGAAACGAAGCAAGAAGG - Intergenic
951425293 3:22537718-22537740 TTGACTGAAAAGAGGCATCAGGG + Intergenic
951482513 3:23176592-23176614 CTAAATGAAAAGAGAAAGAAAGG - Intergenic
951497910 3:23350651-23350673 ATGAATGAAATGAAGCAAGAAGG + Intronic
952472729 3:33672857-33672879 ATGAATGAAATGAAGCAAGAAGG + Intronic
952639025 3:35569036-35569058 CTGCCTGAAATGAGGCAGGTAGG + Intergenic
953094776 3:39764739-39764761 TTGAATGCAAAGGGGCATGAGGG + Intergenic
953271404 3:41448756-41448778 CTTGATGAAACGGGGCAGGATGG + Intronic
953555629 3:43944735-43944757 ATGAATGAAATGAAGCAAGAAGG - Intergenic
953624687 3:44561222-44561244 CAGAAGGCAAAGAGGAAGGAAGG + Intronic
954048524 3:47953073-47953095 TTGATTGCAAAGGGGCAGGAGGG + Intronic
954890788 3:53926475-53926497 ATGAATGAAATGAAGCAAGAAGG - Intergenic
955099514 3:55833023-55833045 ATGAATGAAATGAAGCAAGAAGG + Intronic
955117870 3:56023757-56023779 ATGAATGAAAAAAGGAATGAAGG + Intronic
955120156 3:56050060-56050082 CTGACTGCAAAGGGGCATGAGGG + Intronic
955614704 3:60794342-60794364 ATAAATGCAAAGAGGAAGGAAGG + Intronic
955626519 3:60924974-60924996 ATGAATGAAATGAAGCAAGAAGG + Intronic
955694672 3:61623975-61623997 CTGAATGCAAGGAGGCAGTGAGG - Intronic
955749321 3:62171545-62171567 CTGACTGCAAATGGGCAGGAAGG - Intronic
956038072 3:65117275-65117297 TGGAATGCAAAGAGGCTGGAAGG + Intergenic
956328648 3:68081039-68081061 ATGAATGAAATGAAGCAAGAAGG - Intronic
956486024 3:69722721-69722743 CGGAAGGAAAAAAGGAAGGAAGG + Intergenic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
956954227 3:74318064-74318086 ATGAATGAAATGAAGCAAGAAGG - Intronic
957308446 3:78488441-78488463 ATGAATGAAATGAAGCAAGAAGG + Intergenic
958265080 3:91429060-91429082 GGGTATGAAAAGAGGTAGGAAGG + Intergenic
958735701 3:98007231-98007253 CTGACTGAAATGAGGGAGAAGGG + Intronic
959240866 3:103792354-103792376 AGGAAGGAAAAGAGGAAGGAAGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959501652 3:107113682-107113704 TGGAAGGAAAAGAGGCAGAAGGG + Intergenic
959554022 3:107696924-107696946 ATGAATGAAATGAAGCAAGAAGG - Intronic
959629056 3:108487643-108487665 ATGAGTGAAAAGGGACAGGAGGG + Intronic
960089818 3:113627872-113627894 CTGCAAGAAAGGAGGCAGAAGGG + Exonic
960287168 3:115842662-115842684 CTGATTAGAGAGAGGCAGGAAGG + Intronic
960553802 3:119006190-119006212 ATGAATGAAAAGAAGCGAGAAGG - Intronic
960563484 3:119111317-119111339 ATGAATGAAATGAAGCAAGAAGG - Intronic
961355099 3:126332836-126332858 ATGAATGAAATGAAGCAAGAAGG + Intergenic
962529440 3:136265339-136265361 CTGACTGCAAACAGGCAAGAAGG - Intronic
962698459 3:137973897-137973919 AGGAAAGAAAAGAGGAAGGAAGG + Intergenic
962938986 3:140108448-140108470 GGGAATGGAAAGAGGCAGGGAGG - Intronic
963541798 3:146600377-146600399 CTGGATTGGAAGAGGCAGGAAGG + Exonic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964550655 3:157880757-157880779 ATGAATGAAATGAAGCAAGAAGG + Intergenic
964772754 3:160241012-160241034 GTGATTGAAATGAGTCAGGATGG + Intronic
965974644 3:174606585-174606607 ATGAATGAAATGAAGCAAGAAGG + Intronic
966045071 3:175538834-175538856 CTGAATGGAAAGAGGTAAGCTGG - Intronic
966385144 3:179388218-179388240 CTGAATGAATAGAGGTAGCCTGG + Intronic
966504502 3:180684523-180684545 CTGACTGGAAAGAGGCATGAGGG - Intronic
966680191 3:182633690-182633712 CAGAAAGAAAAGAGCCTGGAGGG + Intergenic
966861396 3:184232842-184232864 TTGAATGGAAAGAGGCAGGCAGG + Intronic
967092717 3:186149081-186149103 GTGAGTGCAAAGAAGCAGGAGGG + Exonic
967397211 3:189021958-189021980 ATGAATGAAATGAAGCAAGAAGG - Intronic
967985152 3:195088941-195088963 ATGAATGAAATGAAGCAAGAAGG + Intronic
968020417 3:195382469-195382491 GGGAATGAAAAGAAGAAGGACGG - Intronic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969449785 4:7266405-7266427 CTGAAAGAAAGAAGGGAGGAGGG - Intronic
969500414 4:7549266-7549288 CTGAGTTGAAAGAAGCAGGAAGG - Intronic
969684586 4:8664064-8664086 CTGAAAGAAAAAGGGCAGCAGGG + Intergenic
969950172 4:10828026-10828048 ATGAATGAAATGAAGCAAGAAGG - Intergenic
970020186 4:11558852-11558874 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970084968 4:12335824-12335846 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970220003 4:13800264-13800286 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970241489 4:14014185-14014207 ATGAATGAAATGAAGCAAGAAGG - Intergenic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
970283369 4:14482029-14482051 ATGAATGAAATGAAGCAAGAAGG + Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
972103208 4:35447748-35447770 ATGAAGGAAAAAAGGAAGGAAGG + Intergenic
973124668 4:46568521-46568543 ATGAATGAAATGAAGCAAGAAGG + Intergenic
973213262 4:47639556-47639578 CTGAATGTACAAAGGCAGGCTGG + Intronic
973399113 4:49622329-49622351 ATGAATGAAATGAAGCAAGAAGG + Intergenic
973549005 4:52012610-52012632 ATGAGTGAAAAGAGGCTGTATGG + Intronic
973899920 4:55458384-55458406 CTGACTGGAAAGAGGCAGCCAGG - Intronic
974407564 4:61495441-61495463 ATGAAAGAAAAAAGGAAGGAAGG + Intronic
974441562 4:61924849-61924871 ATGAAAGAAAATAGACAGGATGG - Intronic
974862621 4:67541841-67541863 AGGAATGAGAGGAGGCAGGAAGG - Intronic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
975154690 4:71058560-71058582 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975165373 4:71172624-71172646 CTGAATGAAAAGAGATATGTTGG + Intergenic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975187464 4:71420251-71420273 ATGAATGAAATGAAGCAAGAAGG + Intronic
975513492 4:75219736-75219758 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975518713 4:75275308-75275330 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975535608 4:75447263-75447285 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975642624 4:76515383-76515405 CTGAAAAAAAAAAGGAAGGAAGG + Intronic
975750529 4:77518521-77518543 ATGAATGAAATGAAGCAAGAAGG - Intronic
976342045 4:83956910-83956932 ATGAATGAAATGAAGCAAGAAGG - Intergenic
976352285 4:84073772-84073794 ATGAATGAAATGAAGCAAGAAGG + Intergenic
976372009 4:84300057-84300079 ATGAATGAAATGAAGCAAGAAGG + Intergenic
976529560 4:86135950-86135972 ATGAATGAAATGAAGCAAGAAGG + Intronic
976532358 4:86169479-86169501 ATGAATGAAATGAAGCAAGAAGG + Intronic
976905289 4:90228886-90228908 GTGAATGAAATGAAGCAAGAAGG + Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
976982936 4:91254535-91254557 CTGAATGAAAAGGGAAAAGAGGG + Intronic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
977164486 4:93678192-93678214 ATGAATGAAATGAAGCAAGAAGG + Intronic
977516086 4:98022744-98022766 ATGAATGAAATGAAGCAAGAAGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978048462 4:104164877-104164899 CTGAATGAAAAGTAGCTTGAAGG + Intergenic
978246222 4:106575773-106575795 ATGAATGAAATGAAGCAAGAAGG - Intergenic
978274774 4:106936381-106936403 ATGAATGAAATGAAGCAAGAAGG + Intronic
978554968 4:109970181-109970203 CTGAATGGCAGGAAGCAGGAAGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978864671 4:113493869-113493891 ATGAATGAAATGAAGCAAGAAGG - Intronic
979187104 4:117810818-117810840 CTGAACGACAGGAGGCAGGAGGG - Intergenic
979196274 4:117923265-117923287 GTGAATGAAATGAAGCAAGAAGG + Intergenic
979299067 4:119066631-119066653 ATGAATGAAATGAAGCAAGAAGG - Intergenic
979299913 4:119075041-119075063 ATGAATGAAATGAAGCAAGAAGG + Intergenic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979634718 4:122944362-122944384 ATGAATGAAATGAAGCAAGAAGG - Intronic
979640027 4:123003031-123003053 ATGAATGAAATGAAGCAAGAAGG - Intronic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
979753458 4:124308872-124308894 TTGACTGAAAAGAGGCTTGAGGG + Intergenic
979887467 4:126047001-126047023 ATGCATGAAAAGAAACAGGAAGG + Intergenic
979961090 4:127021843-127021865 ATGAATGAAATGAAGCAAGAAGG + Intergenic
979965030 4:127067304-127067326 ATGAATGAAATGAAGCAAGAAGG - Intergenic
980010619 4:127590211-127590233 ATGAATGAAATGAAGCAAGAAGG + Intergenic
980018301 4:127678016-127678038 ATGAATGAAATGAAGCAAGAAGG + Intronic
980033827 4:127860939-127860961 ATGAATGAAATGAAGCAAGAAGG + Intergenic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
981157299 4:141453994-141454016 ATGAATGAAAAGAGAAATGAAGG - Intergenic
981439820 4:144769955-144769977 ATGAATGAAATGAAGCAAGAAGG + Intergenic
982511550 4:156289315-156289337 ATGAATGAAATGAAGCAAGAAGG - Intergenic
982905923 4:161070511-161070533 CTTAATGAAAAGAGGCAACTAGG + Intergenic
983173117 4:164558223-164558245 ATGAATGAAATGAAGCAAGAAGG - Intergenic
983329269 4:166303519-166303541 CTGCTTGAAAAGATGCAGAATGG + Intergenic
983349684 4:166571254-166571276 ATGAATGAAATGAAGCAAGAAGG + Intergenic
984044466 4:174779728-174779750 ATGAATGAAATGAAGCAAGAAGG + Intronic
984302065 4:177933913-177933935 AGGAAAGAAAAGAGGAAGGAAGG - Intronic
984446927 4:179849024-179849046 CTGAGAGAAAAAAGGCATGAAGG + Intergenic
984659824 4:182361446-182361468 ATGAATGAAATGAAGCAAGAAGG - Intronic
985428091 4:189849684-189849706 CTGACTGACAAGGGGCAAGAGGG + Intergenic
986090589 5:4501072-4501094 ATGAATGAAATGAAGCAAGAAGG - Intergenic
986101616 5:4616705-4616727 ATGAATGAAATGAAGCAAGAAGG + Intergenic
986978354 5:13417776-13417798 ATGAATGAAATGAAGCAAGAAGG + Intergenic
987232634 5:15911251-15911273 ATGAATGAAATGAAGCAAGAAGG - Intronic
987273414 5:16336688-16336710 ATGAATGAAATGAAGCAAGAAGG + Intergenic
987274085 5:16343835-16343857 CTTAAGGGAAAGAGGCAGAAAGG - Intergenic
987984950 5:25134329-25134351 CTGCATGAAAGCAGCCAGGAGGG + Intergenic
988375278 5:30428100-30428122 ATGAATGAAATGAAGCAAGAAGG - Intergenic
988399728 5:30747331-30747353 CTGAATGAATACAGACATGAAGG + Intergenic
988412487 5:30904929-30904951 ATGAATGGAAGGAAGCAGGATGG + Intergenic
988690809 5:33570011-33570033 ATGAATGAAATGAAGCAAGAAGG + Intronic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
989306692 5:39966038-39966060 CTGTTTAAAAAGATGCAGGAAGG - Intergenic
989350981 5:40486426-40486448 GTGAATGAGAAGATGCTGGAGGG - Intergenic
989493078 5:42079560-42079582 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989653527 5:43719230-43719252 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989725341 5:44580203-44580225 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989732998 5:44669779-44669801 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989794179 5:45446303-45446325 ATGAATGAAATGAAGCAAGAAGG + Intronic
989849799 5:46194693-46194715 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989857253 5:46313624-46313646 ATGAATGAAATGAGGCGAGAAGG + Intergenic
989947893 5:50261707-50261729 ATGAATGAAATGAAGCAAGAAGG - Intergenic
989968066 5:50488711-50488733 ATGAATGAAATGAAGCAAGAAGG - Intergenic
990381646 5:55226168-55226190 CGGAATGAAAATGGCCAGGAAGG + Intronic
990706972 5:58540862-58540884 ATGAATGAAATGAAGCAAGAAGG - Intergenic
991430653 5:66541504-66541526 CTGGAAGAAAGGAGGCTGGAGGG - Intergenic
991689359 5:69211617-69211639 CTGCATGAAAGGATGCAGAAAGG - Intergenic
992148643 5:73879151-73879173 ATGAATGAAATGAAGCAAGAAGG - Intronic
992329099 5:75696970-75696992 ATGAATGAAATGAAGCAAGAAGG + Intronic
992360848 5:76036971-76036993 ATGAATGAAATGAAGCAAGAAGG - Intergenic
992605967 5:78456911-78456933 ATGAATGAAATGAAGCAAGAAGG - Intronic
992651962 5:78868077-78868099 ATGAATGAAATGAAGCAAGAAGG + Intronic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
993006486 5:82434132-82434154 ATGAATGAAATGAAGCAAGAAGG - Intergenic
993015398 5:82530100-82530122 CTGCAGGAAAAGAGAAAGGAGGG - Intergenic
993044628 5:82853470-82853492 GTGATTGGAAGGAGGCAGGAGGG - Intergenic
993185911 5:84619408-84619430 CAGAAAGAAAGGAAGCAGGATGG + Intergenic
993261403 5:85662323-85662345 ATGAATGAAATGAAGCAAGAAGG - Intergenic
993312786 5:86357669-86357691 CTGCATGAAAAGAGGGAGAGTGG - Intergenic
993449252 5:88053609-88053631 ATGAATGAAATGAAGCAAGAAGG + Intergenic
993526874 5:88975887-88975909 ATGATTGCCAAGAGGCAGGAGGG + Intergenic
993569583 5:89520674-89520696 TTGAAAGAAAAGAGGAAGGGAGG + Intergenic
993714667 5:91264145-91264167 CTGACTGAAAAGAGGTATTAGGG + Intergenic
994233387 5:97335125-97335147 CTTAATGAAATGAAGCATGAAGG - Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
994558035 5:101330124-101330146 CTGACTGAGAAGGGGCAGTAGGG - Intergenic
994898576 5:105739675-105739697 CAGGAGGAAAAGAGGCAGGTAGG - Intergenic
995309428 5:110693719-110693741 ATGAATGAAATGAAGCAAGAAGG + Intronic
995334867 5:110987006-110987028 ATGAATGAAATGAAGCAAGAAGG + Intergenic
995335487 5:110994041-110994063 CTTAATGAAAAAAAGAAGGAAGG + Intergenic
995413329 5:111882245-111882267 ATGAATGAAATGAAGCAAGAAGG + Intronic
996348585 5:122514336-122514358 ATGAATGAAATGAAGCAAGAAGG - Intergenic
996353124 5:122567716-122567738 CTGCATCAAAAAAGGCAAGAAGG + Intergenic
996654713 5:125923138-125923160 ATGAATGAAATGAAGCAAGAGGG - Intergenic
996753012 5:126908547-126908569 ATGAATGAAATGAAGCAAGAAGG - Intronic
996773264 5:127107829-127107851 ATGAATAAAATGAAGCAGGAAGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997438910 5:133895121-133895143 CTGAAAGCAAAGTGTCAGGAGGG + Intergenic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
998077892 5:139251228-139251250 CAGAATGAATCGGGGCAGGAAGG - Intronic
998595772 5:143528492-143528514 CTGAATGACAAGATGCAGTTAGG + Intergenic
998669657 5:144339726-144339748 AGGAAAGAAAAGAGGAAGGAGGG - Intronic
998733847 5:145112128-145112150 AGGTATGAAAAGAGGCTGGAGGG + Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999058804 5:148610942-148610964 ATGAATGAAATGAAGCAAGAAGG + Intronic
999844572 5:155464885-155464907 TTGAAGGAAAAGAGGAAGTATGG - Intergenic
999867642 5:155718664-155718686 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1000147189 5:158464995-158465017 CTCAGTCAAATGAGGCAGGAAGG - Intergenic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000469627 5:161624384-161624406 CTGACTGAAAAGGGGCATGAGGG + Intronic
1000681006 5:164184511-164184533 ATGAATGAAATGGGGAAGGAAGG + Intergenic
1000808605 5:165831292-165831314 GTGAATGAAAAAAGGCAGGGAGG - Intergenic
1001905750 5:175471689-175471711 CTGACTGAGAAAGGGCAGGAGGG + Intergenic
1002010971 5:176281157-176281179 ATGAATGAAATGAAGCAAGAAGG - Intronic
1002232117 5:177773524-177773546 ATGAATGAAATGAAGCAAGAAGG + Intronic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1002675249 5:180907249-180907271 ATGAATGAAATGAAGCAAGAAGG - Intronic
1003169489 6:3709856-3709878 CTGAATGCAGGCAGGCAGGAAGG + Intergenic
1003239688 6:4333469-4333491 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1003399881 6:5782662-5782684 AGGAAAGAAAAGAGGAAGGAAGG - Intergenic
1003759680 6:9162721-9162743 ATGAAAGAAAAAAGGAAGGAAGG + Intergenic
1003790694 6:9544068-9544090 CTGAATGACAAGAGGCAGGTCGG + Intergenic
1003912609 6:10756095-10756117 CTGAAGCAAAAGAGTCAGTATGG + Intronic
1004200879 6:13546803-13546825 CTGAATTACAAAAGGGAGGAGGG - Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004819118 6:19347750-19347772 CTCAATTAAAACAGGCAGGCTGG + Intergenic
1005239296 6:23805329-23805351 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1005420031 6:25639577-25639599 TTGACTAAAAACAGGCAGGATGG - Intergenic
1006827155 6:36943975-36943997 AAGAAAGAAAAGAGGAAGGAAGG + Intergenic
1007137301 6:39534477-39534499 ATGAATGAAATGAAGCAAGAAGG + Intronic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1008212189 6:48738623-48738645 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1008262872 6:49388158-49388180 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1008412109 6:51192389-51192411 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1008769614 6:54962701-54962723 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1008778323 6:55068746-55068768 CTGAATGAAAAGAGCAAAGCTGG - Intergenic
1008915653 6:56784451-56784473 ATGAATGAAATGAAGCAAGAAGG - Intronic
1008990304 6:57593592-57593614 GGGTATGAAAAGAGGTAGGAAGG - Intronic
1009045326 6:58231325-58231347 ATGAATGAAATGAAGCACGAAGG - Intergenic
1009175941 6:60460077-60460099 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009178878 6:60492143-60492165 GGGTATGAAAAGAGGTAGGAAGG - Intergenic
1009221141 6:60985656-60985678 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009239046 6:61162283-61162305 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009870194 6:69444267-69444289 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009880388 6:69559946-69559968 AGGAATGAAAAGAGGAAGAAAGG - Intergenic
1010019395 6:71141612-71141634 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1010025360 6:71209389-71209411 CTGAATCTAGAGAGACAGGAGGG + Intergenic
1010263206 6:73840138-73840160 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1010271338 6:73918916-73918938 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1010319032 6:74485283-74485305 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1010441870 6:75904454-75904476 ATGAATGAAATGAAGCAAGAAGG - Intronic
1010592818 6:77730521-77730543 CTGAAAGAAAAGAGTTAGTAGGG - Intronic
1010593265 6:77735360-77735382 ATGAATGAAATGAAGCAAGAAGG - Intronic
1011180064 6:84609715-84609737 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011181627 6:84627624-84627646 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011244568 6:85308444-85308466 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011315426 6:86026215-86026237 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1011374708 6:86676480-86676502 CTGAAAGAAAAGTGGCAGGGTGG + Intergenic
1011392955 6:86874234-86874256 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011395235 6:86898984-86899006 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011397265 6:86922573-86922595 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1011550287 6:88525935-88525957 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1011751950 6:90462663-90462685 TAGAATGAAAAGGGGCAGGAAGG - Intergenic
1012081108 6:94759172-94759194 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1012108022 6:95190781-95190803 ATAAATGAAAAGACACAGGAAGG + Intergenic
1012513307 6:100029600-100029622 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1012540482 6:100355983-100356005 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1012602725 6:101117622-101117644 CACAATGCAAAGTGGCAGGAAGG + Intergenic
1012843628 6:104362032-104362054 CTCAGTGAAAAGAGGCAGTGTGG - Intergenic
1013344780 6:109249951-109249973 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1013622868 6:111907722-111907744 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1013704325 6:112814299-112814321 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1013966491 6:115961310-115961332 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014105822 6:117559334-117559356 GTGAATGAAAGGAGGAAGGAAGG + Intronic
1014120807 6:117722703-117722725 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1014145830 6:117997189-117997211 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014364614 6:120523732-120523754 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1014373482 6:120642221-120642243 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1014414256 6:121163972-121163994 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014415119 6:121174414-121174436 CTGAATCAAAAGAGTCAGCACGG + Intronic
1014529444 6:122541909-122541931 ATGAATGAAATGAAGCAAGAAGG - Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014704306 6:124726972-124726994 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014711000 6:124805904-124805926 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014732968 6:125055754-125055776 ATGAATGAAATGAGGAAAGAAGG - Intronic
1014871205 6:126598548-126598570 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1015056581 6:128910363-128910385 ATGAATGAAATGAAGCAAGAAGG - Intronic
1015620758 6:135129409-135129431 ATGAAAGAAAGGAGACAGGAAGG + Intergenic
1015865642 6:137723796-137723818 TTGAATGAAAAAAGGGAGGGAGG - Intergenic
1016426464 6:143941436-143941458 ATGATGGAAATGAGGCAGGATGG + Exonic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016635320 6:146282479-146282501 ATGAAAGAAAAGATGAAGGAAGG + Intronic
1016810502 6:148256697-148256719 TTGACTGCAAAGAGGCAGAAGGG + Intergenic
1016868637 6:148795227-148795249 CTGAATGAGAAGGGACAGGAGGG + Intronic
1017642936 6:156511988-156512010 TTGAATGCAAAGATACAGGATGG - Intergenic
1017815392 6:158012456-158012478 CTGAATTTGAAGAGGAAGGAAGG + Intronic
1018080055 6:160251514-160251536 CAGAAGGAAAAAAGGAAGGAAGG - Intronic
1018500627 6:164407006-164407028 CTGAAATAACAGAGCCAGGAAGG - Intergenic
1018532882 6:164786684-164786706 CTGAATGAAATGAAGCGAGAAGG - Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019146228 6:169977125-169977147 CTGAATGAAAGAAAGGAGGAGGG - Intergenic
1019332415 7:466889-466911 CTCAATGGAAAGAGGGATGATGG - Intergenic
1019706635 7:2500046-2500068 CTGAAAGAAGGGAGCCAGGAGGG - Intergenic
1020061635 7:5156892-5156914 TTGAGTGAAAAGAGACATGAAGG - Intergenic
1020166523 7:5811769-5811791 TTGAGTGAAAAGAGACATGAAGG + Intergenic
1020434247 7:8145373-8145395 CAGAATGAACAAAGACAGGAAGG - Intronic
1020478122 7:8623158-8623180 CTGAATTTAATGATGCAGGAGGG + Intronic
1020724546 7:11794502-11794524 CTGATACAAAAGAGGCAGGGGGG - Intronic
1020893253 7:13906110-13906132 ATTAGAGAAAAGAGGCAGGAGGG - Intronic
1021112428 7:16710584-16710606 CTGAAGGAAAGAAGGAAGGAAGG + Intergenic
1021319885 7:19196661-19196683 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1021374389 7:19888689-19888711 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1021618758 7:22529575-22529597 ATGAATGAAATGAAGCAAGAAGG + Intronic
1021671277 7:23037006-23037028 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1021701379 7:23322336-23322358 GTGAATGAAATGAAGCAAGAAGG + Intronic
1021874207 7:25033284-25033306 CTAACTGCAAAGAAGCAGGAGGG - Intergenic
1022213403 7:28234027-28234049 AAGAAAGAAAAGAGGAAGGAAGG - Intergenic
1022309855 7:29186597-29186619 AGGAAGGAAGAGAGGCAGGAAGG + Intronic
1022340728 7:29465052-29465074 CAGAAGGAAAAAAGGCAAGAAGG - Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022498686 7:30869080-30869102 CTGGATGACAGGAGCCAGGAGGG - Intronic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1022586828 7:31621022-31621044 ATGAATGAAATGAAGCAAGAAGG + Intronic
1022654873 7:32309164-32309186 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023084559 7:36557711-36557733 ATGAATGAAATGAAGCAAGAAGG - Intronic
1023377824 7:39576446-39576468 GTGAATGGAAAGAGGCAGGTGGG - Intronic
1024022158 7:45382227-45382249 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1024657008 7:51459425-51459447 CTGAATGAACAGACGCAGACTGG - Intergenic
1024694172 7:51838188-51838210 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1024916249 7:54503447-54503469 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1026210317 7:68298369-68298391 CTCAAGGAAAAGAGGCATCATGG + Intergenic
1026739175 7:72967950-72967972 ATGACTGGAAGGAGGCAGGAGGG - Intronic
1027104556 7:75397123-75397145 ATGACTGGAAGGAGGCAGGAGGG + Intronic
1027892414 7:83994042-83994064 ATGAATGAAATGAGGCGAGAAGG - Intronic
1028270960 7:88788433-88788455 CTGAATGAAAAGAGGTGGGGTGG - Intronic
1028341142 7:89720925-89720947 CTGAATGATACTAGGCAGAAAGG + Intergenic
1028381786 7:90208336-90208358 CTGAAAAAAAAGAGAAAGGAAGG + Intronic
1028499949 7:91508119-91508141 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1028508028 7:91591057-91591079 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1028684372 7:93575511-93575533 GTGAATGAAAACAGAGAGGATGG + Intergenic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1028877135 7:95836694-95836716 ATGAATGAAATGAAGCAAGAAGG - Intronic
1029011066 7:97262785-97262807 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1029059041 7:97778055-97778077 ATGAATGAAATGACGCAAGAAGG - Intergenic
1029296657 7:99545471-99545493 CTGATGGAAAAGAGGAAGCAAGG + Intergenic
1029600620 7:101561248-101561270 ATGAAGGAAAGGAGGAAGGAAGG - Intergenic
1030329619 7:108257206-108257228 CTGACTATAAACAGGCAGGAGGG + Intronic
1030466506 7:109909477-109909499 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1030507553 7:110443918-110443940 CTGGATTCAAAGATGCAGGAGGG - Intergenic
1030639402 7:111987282-111987304 CAGAATGAAAAGGGGAAGGAAGG - Intronic
1032310751 7:130784561-130784583 GTGACTGCAAAGAGGCAGGGGGG - Intergenic
1032828208 7:135593419-135593441 CTGAAAGAAAATAGTCAGAAGGG + Intronic
1033269882 7:139921217-139921239 TTGACTGAGAAGAGGCATGAGGG - Intronic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1033932635 7:146543397-146543419 CTGAATGGAAAGGGGAATGAGGG - Intronic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034982731 7:155489079-155489101 CTAAATGAGAAGTGGCAGGGAGG - Intronic
1035792692 8:2322437-2322459 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1035800112 8:2399268-2399290 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1037126880 8:15362250-15362272 TTGAAGGAAAAGAGGTATGATGG - Intergenic
1038049487 8:23795528-23795550 CTTAATGAAAATAGGCATGAAGG + Intergenic
1038234089 8:25735068-25735090 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1038305457 8:26396887-26396909 ATGAATGAAATGAAGCAAGAAGG + Intronic
1038573954 8:28687755-28687777 ATGAAAGAAAAGAGAAAGGATGG + Intronic
1038902157 8:31856339-31856361 ATGAATGAAATGAAGCAAGAAGG - Intronic
1039300060 8:36199974-36199996 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1039373064 8:37006147-37006169 TTGAATGAAGAGAGGTAAGAAGG + Intergenic
1039421575 8:37447761-37447783 CTGACTGCAAAGAGGCATGAAGG + Intergenic
1039753625 8:40499256-40499278 CTGAAAGAAAAGAGGAAGGGCGG + Intergenic
1040398254 8:47020009-47020031 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1041613911 8:59883257-59883279 ATGAATGAAAAGAAGCGAGAAGG + Intergenic
1042164379 8:65931175-65931197 GTGAAGGAAGAAAGGCAGGAAGG - Intergenic
1043016602 8:74947378-74947400 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1043191034 8:77223590-77223612 CCCAATTAAAAGACGCAGGATGG - Intergenic
1043272500 8:78351908-78351930 ATGAATGAAATGAAGCGGGAAGG + Intergenic
1043506324 8:80906786-80906808 AAGAAAGAAAAGAGGAAGGAAGG - Intergenic
1043663845 8:82782986-82783008 TTAAATGAAGAAAGGCAGGAAGG + Intergenic
1043757304 8:84019567-84019589 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1043976506 8:86591066-86591088 ATGAATGAAATGAAGCAAGAAGG - Intronic
1043995145 8:86805076-86805098 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1044353735 8:91196571-91196593 ATGAATGAAATGAAGCAAGAAGG - Intronic
1045141440 8:99289057-99289079 ATGAATGAAAGAAGGAAGGAAGG + Intronic
1045200763 8:99978479-99978501 AAGAAAGAAAAGAGGGAGGAGGG - Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1045487133 8:102640458-102640480 CCGAATGAAGGGAGGAAGGAAGG + Intergenic
1046389401 8:113549350-113549372 AGGAAGGAAGAGAGGCAGGAAGG - Intergenic
1046461332 8:114541378-114541400 CATAATCAAAAGAGGCATGAAGG + Intergenic
1046719956 8:117608348-117608370 AGGAATGAAAGGAGGAAGGAAGG - Intergenic
1046746565 8:117882396-117882418 TTGAATGGCAAGTGGCAGGATGG + Intronic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047008748 8:120648893-120648915 ATGAATGAAATGAAGCAAGAAGG - Intronic
1047046138 8:121055416-121055438 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047531851 8:125684159-125684181 ATGACTCTAAAGAGGCAGGAGGG - Intergenic
1047686787 8:127312857-127312879 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1047735287 8:127759762-127759784 AAGAAAGAAAAGAGGCAGCAAGG - Intergenic
1048093276 8:131263513-131263535 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048292457 8:133191292-133191314 CAGGATGAAAAGGGCCAGGAAGG + Intronic
1048323328 8:133418819-133418841 GTGAATGAGATGTGGCAGGAGGG + Intergenic
1048382944 8:133884288-133884310 AAGAAGGAAAAGAGGAAGGAAGG + Intergenic
1048546689 8:135394193-135394215 CTGAAGGAAAAAGGGGAGGAGGG + Intergenic
1048690395 8:136955987-136956009 AGGAAGGAAAAGAGGAAGGAAGG - Intergenic
1048741248 8:137563312-137563334 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048947842 8:139466749-139466771 GTGAAAGAATAGAGTCAGGATGG - Intergenic
1049103933 8:140599465-140599487 CTGAAAGAAGAAAAGCAGGAGGG + Intronic
1049205834 8:141363197-141363219 ATGAATGAAATCAGGCAGGGTGG + Intronic
1049899126 9:140956-140978 ATGAATGAAATGAAGCAAGAAGG + Intronic
1050161053 9:2718764-2718786 CTGAAGGTAGAGCGGCAGGATGG - Exonic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051299155 9:15629442-15629464 ATGAATGAAATGAAGCAAGAAGG + Intronic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051959391 9:22739505-22739527 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1052239201 9:26251048-26251070 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052700905 9:31936946-31936968 ATGAATGAAATGAAGCATGAAGG - Intergenic
1052968447 9:34361154-34361176 AGGGAAGAAAAGAGGCAGGAGGG + Intergenic
1053051315 9:34963022-34963044 CTGAATGAAGAGAGGTGGGGAGG + Intronic
1053730826 9:41055155-41055177 CTGAAGGAAGAAAGGAAGGAAGG + Intergenic
1053742182 9:41151266-41151288 ATGAATGAAATGAAGCAAGAAGG + Intronic
1054345913 9:63914658-63914680 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1054347455 9:63981081-63981103 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1054445181 9:65307424-65307446 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1054485091 9:65714082-65714104 ATGAATGAAATGAAGCAAGAAGG - Intronic
1054686163 9:68280034-68280056 ATGAATGAAATGAAGCAAGAAGG - Intronic
1054753765 9:68935850-68935872 AGGAAAGAAAAGAGGCAGAAAGG + Intronic
1054754471 9:68943360-68943382 CATAAGGAAAAGAGGCATGAAGG + Intronic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1054980591 9:71201600-71201622 ATGAATGAAATGAAGCGGGAAGG - Intronic
1055606767 9:77978427-77978449 AGGCAGGAAAAGAGGCAGGAGGG - Intronic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056406940 9:86283480-86283502 GTGAAGGAAAAAGGGCAGGAGGG + Intergenic
1056472035 9:86915052-86915074 GAGAATGGAAAGAGGAAGGAAGG + Intergenic
1056484644 9:87043154-87043176 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056508189 9:87277335-87277357 CTGAATTAAATGAGGGAGGGCGG + Intergenic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057163019 9:92904643-92904665 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1057479527 9:95433819-95433841 AAGAAAGAAAAGAGGAAGGAAGG - Intergenic
1057728282 9:97585731-97585753 ATGAATGAAATGAAGCAAGAAGG - Intronic
1057745394 9:97747103-97747125 CTTTATTAAAAGAGGCAGCAGGG - Intergenic
1057861868 9:98647020-98647042 CACAATGAGAAGAGGCAGGGAGG + Intronic
1058053638 9:100428914-100428936 AAGAAGGAAGAGAGGCAGGAAGG + Intronic
1058215032 9:102222633-102222655 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1058319410 9:103611006-103611028 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1058388029 9:104461470-104461492 AGGAAGGAAGAGAGGCAGGAAGG + Intergenic
1059108734 9:111534653-111534675 GTGAATGAGAACAGGAAGGAGGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059662545 9:116416246-116416268 GTGAATGCAATAAGGCAGGAGGG + Intergenic
1059769120 9:117411502-117411524 CAGAAACAAAAGAGGCAGAATGG + Intronic
1060166355 9:121419820-121419842 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1060306043 9:122413354-122413376 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1061105008 9:128523257-128523279 CTGCATGAAAAATGGCAGGGAGG - Intronic
1061298209 9:129688588-129688610 CTGAAGGAGAACAGCCAGGAGGG + Intronic
1061431241 9:130532725-130532747 CTGGGGGAAAAGAGGCGGGATGG + Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185820201 X:3195835-3195857 CTGGAAGAAAAGGGGAAGGAAGG + Intergenic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1186955859 X:14681360-14681382 TTGAATGAAAGAAGGAAGGAAGG - Intronic
1187222929 X:17347207-17347229 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1187505320 X:19874472-19874494 GTGAGAGAAGAGAGGCAGGAGGG + Intronic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1187835420 X:23428021-23428043 ATGAATGAAATGAAGCATGAAGG - Intergenic
1187925761 X:24248908-24248930 ATAAATGAAATGAGGCAGAATGG - Intergenic
1187944464 X:24412693-24412715 GTGGATGACAGGAGGCAGGAGGG - Intergenic
1187988141 X:24837232-24837254 CTGACTGGGAAGAGGCACGAGGG - Intronic
1188061902 X:25611197-25611219 CTGTATGAAAAATGGCTGGAAGG - Intergenic
1188405035 X:29797415-29797437 CTGAATGTAAAGAGTCACCAAGG + Intronic
1188505373 X:30876947-30876969 CAGAAGGAAAAGAGACAGAATGG + Intronic
1188522555 X:31055027-31055049 AAGAATGAAAAAAGCCAGGAAGG - Intergenic
1188876983 X:35442272-35442294 CTGAATTCCAAAAGGCAGGAAGG + Intergenic
1189120627 X:38390587-38390609 CTGATTCAAACAAGGCAGGATGG + Intronic
1189364895 X:40380710-40380732 AGGAAGGAAAAGAGGAAGGAAGG + Intergenic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1190135023 X:47788399-47788421 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1190253286 X:48743700-48743722 GTTAATGGAAAGAGCCAGGAAGG + Intergenic
1190519574 X:51263411-51263433 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1190606583 X:52149859-52149881 ATGAATGAAATGAAGCATGAAGG - Intergenic
1190838402 X:54123445-54123467 ATGAATGAAATGAAGCAAGAAGG - Intronic
1191020106 X:55850489-55850511 ATGAATGAAACGAAGCAAGAAGG - Intergenic
1191186171 X:57614564-57614586 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1191649454 X:63520527-63520549 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1191754122 X:64575795-64575817 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1191935988 X:66427532-66427554 ATGAATGAAATGAAGCGGGAAGG + Intergenic
1192137768 X:68620403-68620425 CAAAAAGAAAAGAGGAAGGAAGG - Intergenic
1192376599 X:70569132-70569154 ATGAATGAAATGAAGCAAGAAGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192660392 X:73036405-73036427 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1192854872 X:74998736-74998758 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1192871352 X:75187749-75187771 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1192942424 X:75926415-75926437 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1193009912 X:76664997-76665019 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1193840188 X:86400107-86400129 ATGAATGAAATGAAGCATGAAGG - Intronic
1193915669 X:87359796-87359818 ATGAATGAAAAAATGAAGGAAGG + Intergenic
1194266010 X:91754075-91754097 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1194516677 X:94863653-94863675 ATGAATGAAATGAAGCAAGACGG + Intergenic
1194570383 X:95548611-95548633 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1194907738 X:99598716-99598738 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1194963013 X:100256888-100256910 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1195726424 X:107922158-107922180 CAGAATGGAGAAAGGCAGGAAGG - Intronic
1195764189 X:108278407-108278429 ATGAATGAAATGAAGCAAGAAGG + Intronic
1196077422 X:111593427-111593449 ATGAATGAAATGAGGCGAGAAGG - Intergenic
1196380571 X:115085175-115085197 ATGAATGAAATGAAGCAAGACGG - Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197389263 X:125840264-125840286 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1197619737 X:128734145-128734167 CTGAATGAAATGAAGCAAGAAGG + Intergenic
1197953226 X:131919612-131919634 CTGAAGGAAAAGACACAAGATGG + Intergenic
1198057708 X:133011081-133011103 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1198485070 X:137079449-137079471 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1198686931 X:139237129-139237151 TTGAATGAAAACAGGAAGGAAGG - Intergenic
1198757083 X:139993734-139993756 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1199218337 X:145287192-145287214 GTAAATGAAAAGAGTAAGGAAGG + Intergenic
1199465187 X:148128197-148128219 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1199578260 X:149335277-149335299 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200329568 X:155282184-155282206 CTGAAAGAAAAGTGGGAGCAAGG - Intronic
1200820149 Y:7574772-7574794 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1200889725 Y:8310669-8310691 ATGAATGAAATGAAGCACGAAGG + Intergenic
1200903526 Y:8458051-8458073 ACGAATGAAATGAAGCAGGAAGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201230487 Y:11859793-11859815 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201425881 Y:13850653-13850675 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201536299 Y:15052414-15052436 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201544633 Y:15148190-15148212 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201572323 Y:15427326-15427348 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1201600823 Y:15727046-15727068 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201627198 Y:16027329-16027351 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1201703816 Y:16913468-16913490 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1201919437 Y:19218680-19218702 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1202089184 Y:21171487-21171509 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1202134520 Y:21647812-21647834 TTGAAGGAGAAAAGGCAGGATGG + Intergenic
1202182049 Y:22147982-22148004 CAGAATGAAGAGAGGCAGTGAGG - Intergenic
1202209311 Y:22438420-22438442 CAGAATGAAGAGAGGCAGTGAGG + Intergenic
1202577298 Y:26341013-26341035 ATGAATGAAATGAAGCAAGAAGG + Intergenic