ID: 1014545698

View in Genome Browser
Species Human (GRCh38)
Location 6:122733045-122733067
Sequence CAGGGAAAAAAGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014545698_1014545707 -5 Left 1014545698 6:122733045-122733067 CCCACCACCTTCTTTTTTCCCTG No data
Right 1014545707 6:122733063-122733085 CCCTGGGGTTCTTCTTACTTGGG No data
1014545698_1014545710 23 Left 1014545698 6:122733045-122733067 CCCACCACCTTCTTTTTTCCCTG No data
Right 1014545710 6:122733091-122733113 CCATGCTGCACAGCCTCCGAAGG No data
1014545698_1014545705 -6 Left 1014545698 6:122733045-122733067 CCCACCACCTTCTTTTTTCCCTG No data
Right 1014545705 6:122733062-122733084 TCCCTGGGGTTCTTCTTACTTGG No data
1014545698_1014545711 29 Left 1014545698 6:122733045-122733067 CCCACCACCTTCTTTTTTCCCTG No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014545698 Original CRISPR CAGGGAAAAAAGAAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr