ID: 1014545705

View in Genome Browser
Species Human (GRCh38)
Location 6:122733062-122733084
Sequence TCCCTGGGGTTCTTCTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014545698_1014545705 -6 Left 1014545698 6:122733045-122733067 CCCACCACCTTCTTTTTTCCCTG No data
Right 1014545705 6:122733062-122733084 TCCCTGGGGTTCTTCTTACTTGG No data
1014545703_1014545705 -10 Left 1014545703 6:122733049-122733071 CCACCTTCTTTTTTCCCTGGGGT No data
Right 1014545705 6:122733062-122733084 TCCCTGGGGTTCTTCTTACTTGG No data
1014545697_1014545705 -5 Left 1014545697 6:122733044-122733066 CCCCACCACCTTCTTTTTTCCCT No data
Right 1014545705 6:122733062-122733084 TCCCTGGGGTTCTTCTTACTTGG No data
1014545699_1014545705 -7 Left 1014545699 6:122733046-122733068 CCACCACCTTCTTTTTTCCCTGG No data
Right 1014545705 6:122733062-122733084 TCCCTGGGGTTCTTCTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014545705 Original CRISPR TCCCTGGGGTTCTTCTTACT TGG Intergenic
No off target data available for this crispr