ID: 1014545711

View in Genome Browser
Species Human (GRCh38)
Location 6:122733097-122733119
Sequence TGCACAGCCTCCGAAGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014545699_1014545711 28 Left 1014545699 6:122733046-122733068 CCACCACCTTCTTTTTTCCCTGG No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data
1014545706_1014545711 11 Left 1014545706 6:122733063-122733085 CCCTGGGGTTCTTCTTACTTGGG No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data
1014545703_1014545711 25 Left 1014545703 6:122733049-122733071 CCACCTTCTTTTTTCCCTGGGGT No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data
1014545708_1014545711 10 Left 1014545708 6:122733064-122733086 CCTGGGGTTCTTCTTACTTGGGT No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data
1014545704_1014545711 22 Left 1014545704 6:122733052-122733074 CCTTCTTTTTTCCCTGGGGTTCT No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data
1014545697_1014545711 30 Left 1014545697 6:122733044-122733066 CCCCACCACCTTCTTTTTTCCCT No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data
1014545698_1014545711 29 Left 1014545698 6:122733045-122733067 CCCACCACCTTCTTTTTTCCCTG No data
Right 1014545711 6:122733097-122733119 TGCACAGCCTCCGAAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014545711 Original CRISPR TGCACAGCCTCCGAAGGCTT TGG Intergenic
No off target data available for this crispr