ID: 1014549635

View in Genome Browser
Species Human (GRCh38)
Location 6:122775322-122775344
Sequence TGTACTCTATTCAGTTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014549635_1014549636 22 Left 1014549635 6:122775322-122775344 CCAATAGAACTGAATAGAGTACA No data
Right 1014549636 6:122775367-122775389 AGACAACTTATTTTCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014549635 Original CRISPR TGTACTCTATTCAGTTCTAT TGG (reversed) Intergenic
No off target data available for this crispr