ID: 1014552617

View in Genome Browser
Species Human (GRCh38)
Location 6:122806660-122806682
Sequence CTGGAGAAGAAGAATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014552617_1014552619 3 Left 1014552617 6:122806660-122806682 CCATGTTCATTCTTCTTCTCCAG 0: 1
1: 0
2: 5
3: 71
4: 540
Right 1014552619 6:122806686-122806708 ATAAGTATCAAGAAGAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014552617 Original CRISPR CTGGAGAAGAAGAATGAACA TGG (reversed) Intronic
901093699 1:6661516-6661538 CTGGAGAAGAAGAGTGGTCTTGG - Intronic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904460601 1:30677397-30677419 CTGGAGTGCAATAATGAACAAGG + Intergenic
904589866 1:31607029-31607051 CTGGAGAGGAAGAAATAAAATGG - Intergenic
904835400 1:33332352-33332374 CTCAAGAAGAAGTATGCACAGGG - Exonic
904949913 1:34228608-34228630 CTGGAGAGCAACAAGGAACAAGG - Intergenic
905601355 1:39254575-39254597 CTTGAGAGGAAGAATGTTCACGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906372218 1:45263751-45263773 CTGGAGAAGAGAAATGAAACAGG - Intronic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
908152683 1:61319731-61319753 CTGAAGAAGTAGAATGGATATGG + Intronic
908393624 1:63705457-63705479 CTGAGGAAGCAGTATGAACAAGG - Intergenic
908820672 1:68083074-68083096 CAGGAGAGGGAGAATGAAAAAGG + Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
909498886 1:76311104-76311126 CAGAAGAAGAAGAAATAACAAGG - Intronic
909511831 1:76462052-76462074 CTGCAGAAGAAGCACGTACAGGG - Intronic
909597183 1:77419499-77419521 ATGGAAAAGAAGAAAGAAAAAGG + Intronic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
911058954 1:93731532-93731554 CTGGAAAGGAAGAAGGTACAAGG + Intronic
911421137 1:97642133-97642155 ATGGAGAGGAAGAATCAATATGG + Intronic
911512419 1:98824075-98824097 CTGGGGCAGGAGAATGAACCTGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911912134 1:103650399-103650421 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
911916320 1:103701549-103701571 CTGGAGAAAAAGGGTGAACTGGG - Intronic
911919549 1:103744537-103744559 CTGGAGAAAAAGGGTGAACTGGG + Intronic
912103275 1:106238757-106238779 AGGGAAAAGAAGAAGGAACAAGG + Intergenic
912130853 1:106597981-106598003 ATGGATAAGAAGAATCAATATGG - Intergenic
912392106 1:109310531-109310553 CTGAAGCAGGAAAATGAACATGG - Exonic
912695581 1:111839497-111839519 CTGAAGCAGGAAAATGAACAAGG - Intronic
913419653 1:118651275-118651297 CTGAAGAATAGGAATGAAAATGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914317532 1:146528194-146528216 CTGGAGAGGAGGAAGGATCAAGG + Intergenic
914496824 1:148205166-148205188 CTGGAGAGGAGGAAGGATCAAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915605309 1:156946788-156946810 CTGAAGAGGCAGAATGGACACGG + Intronic
916469738 1:165111629-165111651 CTGGGTAAGAAGGCTGAACATGG - Intergenic
916871537 1:168919881-168919903 CAGGAAAAGAAGAAAGAAAATGG + Intergenic
917690201 1:177460882-177460904 CTGAACAACAAGAAAGAACAGGG - Intergenic
918966502 1:191356531-191356553 ATGGAAAACAAAAATGAACAGGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
920675163 1:208033392-208033414 CTGGTGAAGAACCATGACCACGG - Exonic
921121237 1:212139502-212139524 CTGGACAAGAAGAATGGAATTGG - Intergenic
921719251 1:218452281-218452303 AGGGAGAAGAAGAATGGACACGG - Intergenic
922132227 1:222791102-222791124 CTGGTGAAGAAGAATTACTAGGG + Intergenic
922445008 1:225689763-225689785 CTGGACAAAAGGCATGAACAGGG - Intergenic
922923601 1:229329508-229329530 TTGGAGATGAAGAATCATCATGG + Intronic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923226960 1:231947156-231947178 CTGGGCAAGAAGAATGAAGCTGG + Intronic
923411529 1:233714808-233714830 CTGGTGAGGAAGAAAGCACAGGG + Intergenic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1063478650 10:6350831-6350853 CAGGTGAATAAGAATGTACAAGG + Intergenic
1064033097 10:11895151-11895173 CAGGGGAAGAAGAATTCACAAGG + Intergenic
1064516925 10:16160065-16160087 CAGGAGTAGAAGTAGGAACATGG - Intergenic
1064936382 10:20683294-20683316 CTGGAGAAGAAGGAGCAACCAGG + Intergenic
1065409495 10:25408422-25408444 CTGGACAAGATGGAAGAACAGGG - Intronic
1065826422 10:29576238-29576260 ATTGAGAAGAAGAGTGCACAAGG - Intronic
1066087699 10:31987046-31987068 ATGGATAAGAAGAATCAATATGG + Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1068275599 10:54792004-54792026 CCTGAGAAGTAGAAAGAACAAGG + Intronic
1068318966 10:55384601-55384623 TTAGAGAAGAAGAAAGAACCAGG - Intronic
1069278905 10:66628660-66628682 CTTGTGAAGAAGCATGAAGAAGG + Intronic
1069636257 10:69926707-69926729 TGGGAGAAGAGGAAAGAACAAGG + Intronic
1070024284 10:72617104-72617126 CTGGTGAAGAAGTAGTAACAGGG - Intronic
1070394709 10:76002184-76002206 CCTCAGAAGAAGAGTGAACAGGG - Intronic
1070768615 10:79070047-79070069 ACGGAGAGGAAGAAAGAACACGG - Intronic
1070974290 10:80593138-80593160 CTGAAAAAGAAGAACAAACATGG - Intronic
1071712075 10:88059721-88059743 CTAGAAAAAAATAATGAACAAGG + Intergenic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1072173450 10:92891075-92891097 CTGGAGAAGGAGAATAGTCAAGG + Intronic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1073515409 10:104071388-104071410 AAGGAGTAGAAGAAAGAACATGG - Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078361005 11:10667553-10667575 CTGGACATGTAGAATGAATAGGG - Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1079679507 11:23276616-23276638 CTAAAGAAGAAGAATGAAAATGG + Intergenic
1080097584 11:28427540-28427562 ATGGATAAGAAGAATCAATATGG - Intergenic
1080332390 11:31154193-31154215 CTGTAGAAGAAGCATGGCCAGGG - Intronic
1081032698 11:38106532-38106554 CTGGAAAAGAAAAATTAAAATGG - Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1082642664 11:55684175-55684197 GTAGATAAGAAGACTGAACATGG - Intergenic
1082888980 11:58118306-58118328 GGGGATAAGAAGAAAGAACATGG + Intronic
1083448131 11:62724333-62724355 CGGGATGAGAAGGATGAACATGG - Exonic
1085417793 11:76330772-76330794 CTGGACCTGAAGAATGAAGAGGG - Intergenic
1085501729 11:77030637-77030659 CTGGATGAGAAGAATGAAGGGGG - Intergenic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1086290240 11:85300610-85300632 CTGGACAACATGAATGTACATGG - Intronic
1086401232 11:86462678-86462700 CTGGGGAACAAGAATGGATAAGG + Intronic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087600871 11:100313780-100313802 CTGAAGAGGAAGAATCAGCAAGG + Intronic
1088011812 11:105012227-105012249 CAAGAGCAGAAGAATGAAAACGG + Intronic
1088052651 11:105536657-105536679 CTGGAGAAAAATAATTAAGAGGG - Intergenic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1089137694 11:116262941-116262963 CTGAAAAAGAAGCATGAACCAGG + Intergenic
1090589786 11:128253062-128253084 CTGGAGAAGAAGAATTGTCTTGG + Intergenic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1093013216 12:14129872-14129894 CTGGAGACAACGAATGAAAACGG + Intergenic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094118578 12:26944230-26944252 CTGGAAAAGAAGAAATAAAACGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1096489357 12:52005328-52005350 CTAGAGAAGAAGACTGAGCCAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101793888 12:107955335-107955357 CTGAAGAAGATAAAAGAACAGGG - Intergenic
1102767096 12:115443046-115443068 ATGGAGAGGAAAAAGGAACAGGG - Intergenic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1104646231 12:130499570-130499592 GTGCAGGAGTAGAATGAACACGG - Intronic
1105269081 13:18854080-18854102 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1105640515 13:22259047-22259069 CTGGAAAAAAATAATAAACAAGG - Intergenic
1106484991 13:30164230-30164252 ATGCATGAGAAGAATGAACAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107300168 13:38957917-38957939 CCGCAGAAGTAGAATGCACAGGG + Intergenic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1109706746 13:66104065-66104087 TTGGATATGCAGAATGAACAAGG - Intergenic
1109989903 13:70040905-70040927 CTGGAAAACAAAACTGAACATGG - Intronic
1110863971 13:80374494-80374516 ATGGAGAAGAAACATGAACCGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1111667679 13:91290344-91290366 CTGGAGATGTAGAACCAACAGGG - Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112417957 13:99219641-99219663 CTGGAAAAGAAGAATTATCTTGG - Intronic
1112455614 13:99559721-99559743 CTGGGGAAGAAGGCTAAACAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113139736 13:107133902-107133924 CTGGAGAAGAAGCATTTAGAAGG - Intergenic
1116402028 14:44519361-44519383 CTGGAAACCAAAAATGAACAAGG - Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116505857 14:45680419-45680441 CTGGAGAAAAAGACAGAAAAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1118333192 14:64830229-64830251 CTGGAGTACAATAATGAAAAAGG - Intronic
1118333668 14:64833740-64833762 TGGGATAAGAAGAATGAATATGG - Intronic
1118393319 14:65314908-65314930 GTGGAAAAGAAGAATGCACATGG + Intergenic
1118857862 14:69637909-69637931 CTGGAAAAGAAGATAGAACGTGG - Intronic
1118885993 14:69866237-69866259 CTGGAGAGGAAGAAGGACCCTGG - Intronic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120442600 14:84559218-84559240 CTAGAGAGGGAGAAAGAACAGGG + Intergenic
1121184758 14:91956841-91956863 CTTGAGAAGAAAAATGTGCAGGG + Intergenic
1121217727 14:92261600-92261622 CTGGAGAAGGACAGTGATCAGGG - Intergenic
1122049761 14:99048301-99048323 CTGGAAATCAACAATGAACAAGG + Intergenic
1202830226 14_GL000009v2_random:19908-19930 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1125186876 15:36941033-36941055 CTGCAGAAGAAGAATGGAGGGGG - Intronic
1125354136 15:38799079-38799101 ATGGATAAGAAGAATCAATATGG - Intergenic
1125842011 15:42811687-42811709 CTGGAGAAAAATAAAGGACAAGG - Exonic
1126544260 15:49855274-49855296 CTGACCAATAAGAATGAACATGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127217529 15:56839558-56839580 CTGTATAAGAACTATGAACATGG - Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127671443 15:61198897-61198919 CTGGGTAAGGAGAATGGACAGGG - Intronic
1127691631 15:61402822-61402844 CTTGAGTAGAGGAAGGAACAGGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130437449 15:83915229-83915251 CAGGAGAAGAAGATGAAACAGGG - Intronic
1130622398 15:85477323-85477345 TTGGGGAAGAAGAATGATCTGGG + Intronic
1130757763 15:86783982-86784004 TTGGAGTAGAAGTAAGAACATGG + Intronic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133543747 16:6785185-6785207 CTGGAGAAAAAAAATGACAAAGG + Intronic
1133570838 16:7038456-7038478 CTGGAGAATAAAAATGTACCTGG + Intronic
1134561613 16:15215050-15215072 GTGGAAAAAAAGAATAAACAAGG + Intergenic
1134922151 16:18126676-18126698 GTGGAAAAAAAGAATAAACAAGG + Intergenic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1135395215 16:22126213-22126235 CTGGATATGAATAATGTACATGG - Exonic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1138033358 16:53578845-53578867 CTGGAGAAGAAGCATGGGAAGGG - Intergenic
1139686588 16:68608762-68608784 CTGCAGAATAAGAATGGACCAGG + Intergenic
1140632406 16:76869978-76870000 GTGGAGAAAAAGAATGGATATGG - Intergenic
1140991514 16:80217304-80217326 AGGGAGAAGATGAGTGAACAAGG - Intergenic
1141200406 16:81893376-81893398 CTGCAGAAGATGAATTAACAAGG - Intronic
1141205047 16:81927059-81927081 CTGGATAAGAAGAGAGGACATGG - Intronic
1141896532 16:86962208-86962230 CTGGAGAAGAAGAACTGACCTGG + Intergenic
1142667404 17:1470815-1470837 GTGGTGAAGAAGAATGAATGTGG + Intronic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143389624 17:6552580-6552602 CTGGAGCGGAAGAATGCAGAGGG - Intronic
1143765075 17:9132403-9132425 CTAGAGAAGACGGATGTACAAGG - Intronic
1143907040 17:10217125-10217147 GTGGAGAAGAGGCAGGAACAGGG + Intergenic
1145195029 17:20885111-20885133 GTGGAGAAGAAGAAACAAAATGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146851021 17:36221671-36221693 TTGGGGAAGAAGTATGTACATGG + Intronic
1147124665 17:38358252-38358274 CTGGGGAAGAATAAATAACATGG + Intronic
1147884461 17:43675501-43675523 CTGGAGGAAGAGAATGAACTTGG + Intergenic
1148883307 17:50749843-50749865 CTGCAAATGAAGAATGAAAAAGG - Intronic
1150173778 17:63028141-63028163 CTGTAAACCAAGAATGAACAAGG + Intronic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1153120232 18:1715435-1715457 CTTGAGAATAAGAATAAACCAGG + Intergenic
1153133405 18:1884469-1884491 CTAGATTAGAAGAATGACCAGGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154290528 18:13102379-13102401 CTGGTGGAGACGAATCAACAAGG - Intronic
1154418947 18:14205902-14205924 CTGTAGAAAAAGGAAGAACAGGG + Intergenic
1155165933 18:23232507-23232529 ATGGAGATGATGAATGCACAGGG - Intronic
1155418180 18:25624259-25624281 CTGGAGAAGAATAATAAAATAGG + Intergenic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1157185367 18:45536081-45536103 CTGGACAATAAGAAGGAAAAAGG - Intronic
1157400226 18:47381155-47381177 CTGGATATGCTGAATGAACATGG + Intergenic
1158100405 18:53823423-53823445 ATGGAGAGGAAGAATCAATATGG + Intergenic
1158784840 18:60698108-60698130 CTGGAGAAGAAGTAAAATCATGG - Intergenic
1158832701 18:61297580-61297602 GAGGAGAAGATGAATGAACTTGG + Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1159946497 18:74447914-74447936 CTGGAGAAGAGGAGGGACCAAGG + Intronic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160223527 18:76994063-76994085 ATGGAGGAGAAGAACGTACAAGG - Intronic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160764274 19:800401-800423 CTGGAGAAGAAGAAGGTCCTGGG + Intronic
1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG + Intronic
1163965335 19:20741455-20741477 CTGAAGAAGGAGAAATAACATGG - Intronic
1165154636 19:33779530-33779552 CTGGAGAGGGAGAATGGACATGG - Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167581913 19:50349836-50349858 CTGGAGAAAAAGGGTGAACTGGG + Intronic
1202642465 1_KI270706v1_random:107864-107886 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925631547 2:5898987-5899009 TTGGGGGAGAGGAATGAACATGG - Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926381413 2:12294229-12294251 CTGGAATAAATGAATGAACATGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
926665865 2:15522293-15522315 CTAAAGAAGAAGAATCAATAAGG + Intronic
927316445 2:21688785-21688807 TTGGAGAAGAAGGAAAAACATGG + Intergenic
927440236 2:23110584-23110606 ATGGATAGGAAGAATGAAAATGG - Intergenic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928072087 2:28227257-28227279 CTAGAGAGGAAGCAAGAACAGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928794828 2:35005417-35005439 ATGGATAGAAAGAATGAACATGG + Intergenic
928947574 2:36785538-36785560 CTTGAGATGAAGAATGAAAGAGG - Intronic
929395789 2:41520648-41520670 CTAGAGAAGAAGATTCCACAAGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929915503 2:46132300-46132322 CTGGAGGAAAAGAATGAATGTGG - Intronic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930415626 2:51086971-51086993 CTGGAAAAGAGGAAATAACAGGG - Intergenic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933452850 2:82478780-82478802 CTGGGGAAGAAGAGAGAACTAGG - Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
933997495 2:87680423-87680445 CTGGAGGAGAGGAAGGCACATGG + Intergenic
934498305 2:94831304-94831326 CTGTAGAAGAAGGAAGAACATGG - Intergenic
934535321 2:95128600-95128622 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934535326 2:95128629-95128651 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934924670 2:98373926-98373948 CTGGAGAAGTGGGATGAAAATGG - Intronic
934929172 2:98406090-98406112 CTGGAGATGAAAAATGCAAATGG + Intergenic
934960142 2:98665833-98665855 CTGCAGAAGAGGAAGCAACAAGG + Intronic
934974183 2:98788905-98788927 ATTGAGAAGAAGAAAAAACAGGG - Intergenic
935231744 2:101104410-101104432 CTGGAGAAGAAGAACAAAGTTGG + Intronic
935319498 2:101872042-101872064 TTGGATAAAAAGAATGAAAAAGG - Intronic
935344599 2:102094257-102094279 CTGTAGAAAAATAATAAACAAGG - Intronic
935711003 2:105898293-105898315 CTGGTGAAGAAGATTGAAACTGG - Intergenic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
936296357 2:111270489-111270511 CTGGAGGAGAGGAAGGCACATGG - Intergenic
937399006 2:121565180-121565202 CAGGACAAGAGGCATGAACAGGG + Intronic
937541123 2:122955438-122955460 CTGGAGAATAAGAAAACACAAGG + Intergenic
937547324 2:123038520-123038542 CTAGAGAAGAAGAAATAACAAGG + Intergenic
937758292 2:125567487-125567509 GTGGAGAATAAGAATAAACAAGG + Intergenic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939409652 2:141808099-141808121 CCGGTGAAGAATGATGAACAAGG - Intronic
939648260 2:144729099-144729121 CTGAAGAAGGATAATGAACTAGG - Intergenic
939667352 2:144967915-144967937 TTAGAGCAGAAGAATGAACATGG + Intergenic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
942640626 2:178057670-178057692 GTAGAGAAGAGGAATGAACAAGG - Intronic
942664020 2:178297201-178297223 CTGGAGAGAAAGACTGTACAAGG - Intronic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
943381440 2:187154352-187154374 ATGGAGAATAAGCAAGAACAAGG - Intergenic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945749868 2:213768109-213768131 CTAGTGAAGAGGAAAGAACATGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948306816 2:236954585-236954607 CTGGAGGAGAAACATGAAAAGGG + Intergenic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
1168890187 20:1290355-1290377 CTGGAAGGGAAGAAGGAACAGGG - Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169247674 20:4036569-4036591 TTGGAGAGGACCAATGAACAAGG + Intergenic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171153151 20:22845766-22845788 CTAGAGAGGTACAATGAACACGG + Intergenic
1171464307 20:25317079-25317101 CTGGAGAAGAAAACAGGACATGG + Intronic
1171889568 20:30698047-30698069 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1172199958 20:33118436-33118458 CTGGAGAAGAGGAGTGAAGCAGG + Intergenic
1172347874 20:34218425-34218447 CTGGATAAAAGTAATGAACAAGG - Intronic
1172704045 20:36870070-36870092 CTGGTCAAGAAGAATGGAGAAGG + Intergenic
1173645731 20:44632047-44632069 CTGGAGAAGAAGAATCGAAGAGG - Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173709440 20:45141537-45141559 CTGGAGAACAGGCATGGACATGG - Intergenic
1174283280 20:49454598-49454620 GTGGAGAAAAAGAATGAAGCAGG + Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174684935 20:52445599-52445621 CTGGTGGAGCAGGATGAACAAGG + Intergenic
1174873465 20:54204594-54204616 CTGGGGGAGAAGAATGACAATGG - Intergenic
1176609413 21:8864746-8864768 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1176854359 21:13953375-13953397 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1176969078 21:15245124-15245146 CTGTAAAAGAAGGATAAACATGG + Intergenic
1177250956 21:18590335-18590357 CTGGAGAAAAACACTAAACAAGG + Intergenic
1177392349 21:20492553-20492575 CTGAGGAAGAAGAATGAAGTAGG - Intergenic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1178225542 21:30713381-30713403 CTGGAGAGGAAGGATAAAGAAGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178760599 21:35398580-35398602 CTAGAGAGGAAGAAGGAATAGGG + Intronic
1180102259 21:45594168-45594190 CACGAGGAGAAGAAGGAACAGGG - Intergenic
1180359507 22:11874592-11874614 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1181907758 22:26212829-26212851 CTGGAGAATAAGACTGCAAATGG + Intronic
1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG + Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184277024 22:43414773-43414795 AGGGAGAAGAAGAATGGAAAGGG - Intronic
1184486611 22:44783586-44783608 GTGGAGCAGAGGCATGAACAGGG - Intronic
949127894 3:468499-468521 CAGGAGAATAAGAAAGAAAAAGG + Intergenic
949196069 3:1309564-1309586 CTGAAGAAGAAGAATAAAGTTGG - Intronic
949819728 3:8103235-8103257 CTGTAGCAGAAAGATGAACAAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952258375 3:31714831-31714853 CTGGAGCAGAAGGATGAGCTGGG - Intronic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
953728956 3:45428606-45428628 CTGGAGATGAAGAGTGATAATGG - Intronic
953807829 3:46086610-46086632 CAGGAGGAGAAGAAGGCACAGGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
956056396 3:65303166-65303188 CTGGTGAAGCAGAATGGACAGGG + Intergenic
956205501 3:66750687-66750709 CTGGAAAAGAACCATCAACATGG - Intergenic
956374560 3:68600565-68600587 CTGGACTAAAGGAATGAACAGGG + Intergenic
956672401 3:71703687-71703709 CTGAAGAAAAAGAATGCACTTGG + Intronic
957828734 3:85487465-85487487 CTGAAGAAGAAGAAAGGAAAAGG + Intronic
957943257 3:87032027-87032049 TTGGAGAACAAGAATGTACTAGG - Intergenic
958499545 3:94887853-94887875 CTGGAGAAGAGGCATGGAAATGG + Intergenic
958987840 3:100803207-100803229 CTGGATAAAAAGAATAAATAGGG + Intronic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960456780 3:117882198-117882220 ATGGAGAAGTAGGATAAACAAGG - Intergenic
960485526 3:118248325-118248347 CTGAAGAGTAAGAATAAACATGG - Intergenic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
963982867 3:151559822-151559844 CTGGAGAAAAAGACTTTACATGG + Intergenic
964018643 3:151979264-151979286 TTAGAGAAGAAAAATGAAAAAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
968294442 3:197563406-197563428 AGAGAAAAGAAGAATGAACAAGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969141275 4:5076004-5076026 CTGGAGATGCTGAATTAACATGG + Intronic
969330553 4:6471698-6471720 CTGGAGAAGAAGAGGGACCCGGG - Intronic
969995071 4:11303575-11303597 CGGGAGAAGAACAAGGAAGAAGG - Intergenic
971285274 4:25283091-25283113 CTGGACAAGAAGAACGAAGTTGG + Intergenic
971292367 4:25355879-25355901 CTGGAGCAGAAGAAGGTACTGGG + Intronic
971345436 4:25807787-25807809 CTGGAGAAGAAGGAACAAAAAGG + Intronic
972077614 4:35106394-35106416 CTGGAGAAAAAGGGTGAACTGGG - Intergenic
972373930 4:38452705-38452727 CAGCAGAAGAAGAAAGAATATGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973555809 4:52081560-52081582 ATGGAGAATAAGAATAAAAAGGG - Intronic
973937769 4:55866668-55866690 GTGAATAAGAAAAATGAACACGG + Intronic
974594895 4:64001934-64001956 CTGGAGGAGAAGCTTGAACTCGG + Intergenic
975008380 4:69319587-69319609 ATGGATAGGAAGAATCAACATGG + Intronic
976230700 4:82840029-82840051 CTGGTATAGAAGAATGAACATGG + Intronic
976340125 4:83937798-83937820 CTGGAAAAGAAGAATGGAAAAGG + Intergenic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
976692866 4:87887204-87887226 CAGGAGAAGAAATATGAACTTGG - Intergenic
976969880 4:91091840-91091862 CTGGAGAAAAAGGGTGAACTGGG + Intronic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
978137313 4:105277965-105277987 CTGCATAAGATGAATAAACAGGG + Exonic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978771350 4:112459228-112459250 CTGAAGAAGGATAAAGAACATGG + Intergenic
978804921 4:112789759-112789781 CTAGAGAAGAAGGAAGAATAAGG + Intergenic
978886194 4:113768976-113768998 CAGGAGAATAAGAAATAACAGGG - Intergenic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979564617 4:122140313-122140335 ATGGATAAGAAGAATCAATATGG - Intergenic
979923942 4:126536330-126536352 CTGAGGCAGAAGAATGAACCCGG - Intergenic
980706256 4:136499562-136499584 TTGGAGAAGAAAAGAGAACAAGG + Intergenic
980878287 4:138684199-138684221 CAGGAGCAGAAGTAGGAACAGGG + Intergenic
981023054 4:140048926-140048948 GTGAAGAGGAAGAATGAACAGGG + Intronic
981304056 4:143226945-143226967 CAGGAAAAGAAGTATAAACATGG + Intergenic
981416486 4:144499776-144499798 CTGGAGAAGAAGAAGAGAAATGG - Intergenic
982204794 4:152989671-152989693 CAGCAGAAGAAGGAAGAACAGGG + Intergenic
982295079 4:153819763-153819785 CTGGATAGGAAGAATCAAAATGG + Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982563255 4:156957340-156957362 GTGGTGTAGAAGAATGGACATGG - Intronic
982726469 4:158911421-158911443 CTGGAGAAGATGAATCAGCTGGG - Intronic
982881384 4:160722115-160722137 TTTGAAAAGGAGAATGAACATGG - Intergenic
983436063 4:167717303-167717325 CTGGAGAGCAATGATGAACAGGG - Intergenic
983606030 4:169585186-169585208 CTGAAGAAAAAGAAAGACCATGG + Intronic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984583290 4:181534775-181534797 CTGGAGAGGAAGATGCAACAGGG - Intergenic
1202769830 4_GL000008v2_random:193762-193784 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986283936 5:6346244-6346266 CTAGAGATGAAGAATAAAGAGGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
987783685 5:22470927-22470949 GTGGAGAAAAACAATGATCATGG + Intronic
987929048 5:24379772-24379794 CTGGAGATAAAGAAAGAATAGGG - Intergenic
988016629 5:25567799-25567821 CTGGAGGAGAAGCTTGAACTCGG - Intergenic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
989146376 5:38254671-38254693 CTAGAGAGGAAGCATGAAGAGGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989269359 5:39513888-39513910 CCAGTGAAGAAGAATGAAGATGG - Intergenic
989476487 5:41880240-41880262 GAGGAGATGAAGACTGAACAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990194163 5:53294243-53294265 CTGGGGAGGGAGAATGAAAAAGG + Intergenic
990500381 5:56390347-56390369 CTGGGGAAGGAGCATAAACACGG + Intergenic
993393400 5:87351483-87351505 TTGAAGAAGAAGAGTGCACATGG + Intronic
993715059 5:91268322-91268344 CAGGAGAAGATGAAAGAAAAAGG - Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
994002528 5:94796977-94796999 CTGGGGAAGAAAAATGTCCATGG + Intronic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
994363480 5:98883425-98883447 CTGGTGAAAAAGAAAGAAAACGG + Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996156549 5:120109810-120109832 CTTGAGAGGAAGGATGAAAAGGG + Intergenic
996258005 5:121428739-121428761 ATGGATAGGAAGAATCAACACGG + Intergenic
996436972 5:123444934-123444956 CTGCAGAAGAAGAATTTACAAGG + Intergenic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1000991051 5:167912451-167912473 CTGGAGAACAACAATGAACTGGG - Intronic
1001129335 5:169050764-169050786 CTGAAGAGGAAGAATACACATGG + Intronic
1001163669 5:169344032-169344054 CTGAAGCAAAAAAATGAACATGG + Intergenic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1001728410 5:173928135-173928157 CTGGCGAAGAGGGATGAATAGGG + Intronic
1002407983 5:179051284-179051306 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
1003520161 6:6851490-6851512 CTGGAGAAAAAGAGACAACAGGG + Intergenic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1004050912 6:12078058-12078080 ATGGTGAAGAAGAATGCATATGG + Intronic
1004264670 6:14138662-14138684 ATGGAGATGAAGAATAAATATGG - Intergenic
1004549403 6:16632164-16632186 TTGGGGAAGAAGAGTGAATAGGG - Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1005213665 6:23499145-23499167 ATGTAGAAAAAGAATGGACAAGG - Intergenic
1006761204 6:36463170-36463192 CAGGAAAATAAGAATAAACAAGG - Intronic
1008551894 6:52640469-52640491 CGGGAAAAGAGGAAAGAACAAGG + Intergenic
1008955142 6:57207468-57207490 CTTTAGAAGAATAATGAACTGGG + Intronic
1009509976 6:64538873-64538895 CTGGTGGAGTAGAAAGAACATGG - Intronic
1010231076 6:73535936-73535958 CTAGAAAAGAAGAAAGACCAAGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011528275 6:88290708-88290730 CAGGAGCAGAAGAATGCCCATGG + Intergenic
1013004086 6:106054666-106054688 CTGAAGAAGTAAAATGCACATGG - Intergenic
1013233962 6:108180973-108180995 CTGGGGAAGGAGAAGAAACAGGG - Intronic
1014253932 6:119142634-119142656 CTGGAGAGGAGTAATGGACATGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016961450 6:149676151-149676173 CTGGAGTTAAAGAATGAACTTGG - Intronic
1017657598 6:156645142-156645164 CTGCAGAAGAACAAGGGACATGG + Intergenic
1019487727 7:1296993-1297015 CTGGGGAACAAAAATAAACAAGG + Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020251960 7:6476417-6476439 AGGGGGAAGAAGAAAGAACAGGG + Intronic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1021768408 7:23972116-23972138 TCAGAGAAAAAGAATGAACAGGG - Intergenic
1022077271 7:26984582-26984604 CTGAAGAAGAAGAGTGATCTTGG - Intronic
1022081730 7:27029199-27029221 ATGGAGAAAAAAAAAGAACAAGG - Intergenic
1022628652 7:32064465-32064487 CTGCTGAAGATGAAAGAACAGGG - Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023362419 7:39430440-39430462 CTAGAAAAGAAGAAAGGACAGGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024303865 7:47909853-47909875 CTGGGGAAGAATAGTGAACATGG + Intronic
1024305606 7:47926835-47926857 CTAGAGAAGATGAGTGAACAAGG + Intronic
1024777507 7:52804764-52804786 CTGCAGAACAAAAATCAACAAGG + Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1027814025 7:82945748-82945770 CTGGAAAAGAGTAATGAATAAGG + Intronic
1028194796 7:87893603-87893625 CTTCAGAATAAGAATTAACAGGG - Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1030975433 7:116116203-116116225 ATGGAAAAGAAGAATAAAAATGG + Intronic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1032209498 7:129900535-129900557 ATGGAGAGGAAGAAGAAACATGG - Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032697261 7:134348125-134348147 CTGGAGAGGAATAAGGAAAATGG - Intergenic
1033040859 7:137916864-137916886 CGGGAGAAGATGAGAGAACATGG + Intronic
1033315448 7:140293384-140293406 GTGGAGAACAAGAAGCAACAGGG - Intergenic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1036199592 8:6757036-6757058 CTGGAAAATAAGGATGAATACGG - Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1038208171 8:25489186-25489208 CTGGAGAAGGAAAAGGAACTGGG - Intronic
1039772419 8:40700790-40700812 CTGTAGAAGAAGAATGTACAAGG - Intronic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1040916443 8:52570137-52570159 CTGGAGAACAGGCATGGACATGG - Intergenic
1041934919 8:63323685-63323707 CTGGAGAATAGGAATTAACCAGG + Intergenic
1042323269 8:67501006-67501028 TTGAAAAAGAAGAATGAAAAGGG - Intronic
1042369468 8:67975051-67975073 CTTGAGAAGAAGAATAATAAAGG - Intronic
1042778973 8:72468793-72468815 CTGGACAACAAGAGTGAACTTGG - Intergenic
1042873055 8:73415380-73415402 CTGGAGAAGAATGAGGAAAAAGG - Intergenic
1043039716 8:75247308-75247330 CTGAAGGAGAAAAATGAATAGGG - Intergenic
1043128736 8:76433895-76433917 CTGGACAAGAAGGATGAAATAGG - Intergenic
1043270291 8:78324832-78324854 TTGGAGAAGAATCCTGAACAAGG + Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1043799651 8:84591771-84591793 ATGGGGAAAAAGAAAGAACACGG + Intronic
1043945092 8:86241110-86241132 ATGGATAAGAAGAATGGATAAGG - Intronic
1044465121 8:92493537-92493559 CTGGAGGAGAAGAAAGACAATGG + Intergenic
1045200534 8:99975887-99975909 CTGATTAAAAAGAATGAACATGG + Intronic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045963424 8:107996135-107996157 CTGGAGAAGAGCAATGAAACTGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046823363 8:118659885-118659907 CAGGAGTAGAGGAATGACCAAGG + Intergenic
1047297618 8:123585243-123585265 CTGGAGTAGCAGATTTAACACGG + Intergenic
1047419952 8:124699315-124699337 CATGTGAAGAAGAATGAAAAAGG - Intronic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1047880686 8:129189643-129189665 TTTGAGAAGATGGATGAACAAGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048760425 8:137788470-137788492 CTGGAGAACAAGACTAAATAGGG - Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049565905 8:143338880-143338902 CTGGGGAAGAAGAGGGCACAAGG - Intronic
1049598497 8:143496108-143496130 CTGGAGAAGAGTCAGGAACACGG + Intronic
1049968955 9:804478-804500 CCGGAGAAGAAAATTGAACAAGG - Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050565209 9:6875124-6875146 CTGGAGAAGAGGAAGGAAACGGG - Intronic
1050894354 9:10868238-10868260 CCAGAGAAGAAGTATAAACAAGG + Intergenic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1051027558 9:12631130-12631152 CTGGAAAAAAAGAATCAACAAGG + Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051672738 9:19528495-19528517 CTGGAGCAAAAGAAAGAAAAAGG - Intronic
1052054646 9:23890558-23890580 GTGGAGAAGAAAATGGAACAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053658852 9:40249227-40249249 CTGTAGAAGAAGGAAGAACATGG + Intronic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1053909221 9:42878499-42878521 CTGTAGAAGAAGGAAGAACATGG + Intergenic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054359515 9:64100194-64100216 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1054370972 9:64395517-64395539 CTGTAGAAGAAGGAAGAACATGG + Intronic
1054525746 9:66126995-66127017 CTGTAGAAGAAGGAAGAACATGG - Intronic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054678603 9:67885246-67885268 CTGTAGAAGAAGGAAGAACATGG + Intronic
1055342938 9:75304590-75304612 ATGGAGAGGAAGAATCAATATGG - Intergenic
1055648740 9:78386438-78386460 CGGGAGGAAAAGAATGAAGATGG - Intergenic
1055808922 9:80128416-80128438 CTGGAGAACAGGAATGTGCACGG + Intergenic
1056041663 9:82674515-82674537 CTGAAGAGGAACAATGAACCAGG + Intergenic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1056370254 9:85946847-85946869 CTGAAGAAGATGAATGGATATGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057765584 9:97915147-97915169 GGGGTGAGGAAGAATGAACACGG + Intronic
1058116703 9:101092653-101092675 CTGGAGGATAAGCATGGACATGG - Intronic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059328637 9:113520465-113520487 CTGGGGAAGAACCATGAGCAAGG - Intronic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1059993812 9:119890460-119890482 CTGGAGAATAAAAATGACCAAGG + Intergenic
1060438268 9:123615047-123615069 CTGGAGAATGCGAATGATCATGG + Intronic
1062538946 9:137033014-137033036 CTGGTGTAGAAGAAGGAACCTGG - Exonic
1203694730 Un_GL000214v1:87440-87462 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1203559184 Un_KI270744v1:35819-35841 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203641543 Un_KI270751v1:16623-16645 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186204284 X:7185071-7185093 CCAGAGAACAAGAATGATCAGGG + Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187604177 X:20865112-20865134 CAGGAGACGAGGAAAGAACATGG + Intergenic
1188087098 X:25913021-25913043 GTGGAGATGAAGGAGGAACATGG - Intergenic
1188112771 X:26211733-26211755 CTGGAAAAGAATAATTAAAAGGG - Intergenic
1188342171 X:29017303-29017325 CTGTAGAATAAGAATGAACGTGG + Intronic
1188810140 X:34643699-34643721 CTGCAGAACATCAATGAACATGG + Intronic
1189188874 X:39078694-39078716 ATGGATAGGAAGAATCAACATGG - Intergenic
1191035891 X:56026275-56026297 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
1191664122 X:63680910-63680932 GTAGAGAAGAAGAAGGGACATGG - Intronic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1193414174 X:81201858-81201880 GAGGAGAAGAAGAAAGAAAAAGG - Exonic
1193688398 X:84607758-84607780 ATGGATAAGAAGAATCAATATGG - Intergenic
1193867692 X:86756179-86756201 CTGAGCAAAAAGAATGAACATGG - Intronic
1194189179 X:90813553-90813575 CTGGAGAATAAAAATCAGCATGG + Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1195461320 X:105128655-105128677 CAGAAGAAAAAGAAAGAACACGG - Intronic
1196025771 X:111040088-111040110 CTGAAGAAGAAGACTCAACCTGG + Intronic
1196155131 X:112420105-112420127 CTGGGGAAGAAGATATAACAGGG - Intergenic
1196188810 X:112773500-112773522 TTGGAGAAAAAAAATGTACATGG - Intergenic
1197629663 X:128843741-128843763 CTGGACGAGAAGAATGAAGCTGG - Intergenic
1197711547 X:129674690-129674712 ATGGAGAAAAAGAAAGAAAAGGG - Intergenic
1198662096 X:138980758-138980780 CTGGATGATAAGAATGAATAGGG + Intronic
1198970221 X:142271108-142271130 CTGGAGAAAAAGGGTGAACTGGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199074024 X:143510038-143510060 CTGGAGAAGATGAGAGAATAGGG - Intronic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1200535759 Y:4395446-4395468 CTGGAGAATAAAAATCAGCATGG + Intergenic
1200803100 Y:7404322-7404344 CAGGAGAATGAGAAAGAACACGG - Intergenic
1201270476 Y:12249162-12249184 CTGGAGAAAAAGCGTGAACTGGG - Intergenic
1201680387 Y:16638904-16638926 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
1202181901 Y:22146950-22146972 CTGCAGAAAAATAAAGAACATGG + Intergenic
1202209459 Y:22439452-22439474 CTGCAGAAAAATAAAGAACATGG - Intergenic