ID: 1014553878

View in Genome Browser
Species Human (GRCh38)
Location 6:122821974-122821996
Sequence CTGTGCCAGTGGCAGATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014553874_1014553878 16 Left 1014553874 6:122821935-122821957 CCTTGATTTCTGGCTGGGTATTA No data
Right 1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014553878 Original CRISPR CTGTGCCAGTGGCAGATAGA GGG Intergenic
No off target data available for this crispr