ID: 1014555070

View in Genome Browser
Species Human (GRCh38)
Location 6:122836069-122836091
Sequence TGCCAAGGATACAACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014555065_1014555070 13 Left 1014555065 6:122836033-122836055 CCCGGAGCCTCTGCTATGAACAG No data
Right 1014555070 6:122836069-122836091 TGCCAAGGATACAACCTTGAAGG No data
1014555066_1014555070 12 Left 1014555066 6:122836034-122836056 CCGGAGCCTCTGCTATGAACAGG No data
Right 1014555070 6:122836069-122836091 TGCCAAGGATACAACCTTGAAGG No data
1014555068_1014555070 6 Left 1014555068 6:122836040-122836062 CCTCTGCTATGAACAGGCATTGT No data
Right 1014555070 6:122836069-122836091 TGCCAAGGATACAACCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014555070 Original CRISPR TGCCAAGGATACAACCTTGA AGG Intergenic
No off target data available for this crispr