ID: 1014565749

View in Genome Browser
Species Human (GRCh38)
Location 6:122945671-122945693
Sequence ATGTTATAACAGTTGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014565749_1014565752 30 Left 1014565749 6:122945671-122945693 CCATACTCCAACTGTTATAACAT No data
Right 1014565752 6:122945724-122945746 CTTAAAATTTCATAGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014565749 Original CRISPR ATGTTATAACAGTTGGAGTA TGG (reversed) Intergenic
No off target data available for this crispr