ID: 1014565752

View in Genome Browser
Species Human (GRCh38)
Location 6:122945724-122945746
Sequence CTTAAAATTTCATAGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014565749_1014565752 30 Left 1014565749 6:122945671-122945693 CCATACTCCAACTGTTATAACAT No data
Right 1014565752 6:122945724-122945746 CTTAAAATTTCATAGAAAATTGG No data
1014565750_1014565752 23 Left 1014565750 6:122945678-122945700 CCAACTGTTATAACATAATAAAC No data
Right 1014565752 6:122945724-122945746 CTTAAAATTTCATAGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014565752 Original CRISPR CTTAAAATTTCATAGAAAAT TGG Intergenic
No off target data available for this crispr