ID: 1014567947

View in Genome Browser
Species Human (GRCh38)
Location 6:122973866-122973888
Sequence GAGGAGACGAAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1104
Summary {0: 1, 1: 1, 2: 6, 3: 90, 4: 1006}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014567947 Original CRISPR GAGGAGACGAAGAATGAGGA TGG Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900850011 1:5135401-5135423 CAGGAGGTGAATAATGAGGAGGG - Intergenic
900917351 1:5648094-5648116 GAGGGGACGAAGGAACAGGATGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901192280 1:7419824-7419846 GTGGAGAGGAAGAATGGGGTGGG - Intronic
901445797 1:9307376-9307398 GAGGTGACGCCGAATGTGGATGG - Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901751705 1:11413945-11413967 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
903179811 1:21599510-21599532 GAGGAGACGGAGGGTGTGGACGG - Exonic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903456702 1:23492428-23492450 GAGGAGAGGGAGAGTGAGAAGGG - Intergenic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904295199 1:29515757-29515779 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904974856 1:34448063-34448085 GGGGATAGGAGGAATGAGGATGG - Intergenic
905014359 1:34767085-34767107 GAGGAGACAATGTTTGAGGAGGG - Intronic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906457061 1:46006174-46006196 GAGCAGTCCAAGAATGGGGAAGG - Intronic
907594058 1:55703641-55703663 GAGGAGTGGAAGAGAGAGGAAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
909041367 1:70656264-70656286 GTGGAGACGAAGTAGCAGGAAGG + Intergenic
909471453 1:76033430-76033452 GAGGAGAGAAAGAATTAAGAAGG + Intergenic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
910274803 1:85437429-85437451 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910474824 1:87595615-87595637 GGGGAGAGGAAAAAAGAGGAAGG - Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910510180 1:87994710-87994732 CAGAAGACGAAGAATAAGCAAGG - Intergenic
910876722 1:91885576-91885598 GCGGAGAGGAAGAGTGAGGGCGG + Intronic
910981820 1:92965680-92965702 GAGTAGGTGAGGAATGAGGAAGG + Intergenic
911366096 1:96939206-96939228 GATGAGTGGAAAAATGAGGATGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912168540 1:107069437-107069459 GAGGAGTGGGAGGATGAGGAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912415122 1:109502964-109502986 GAGGAGCCAAAGAATCAGCATGG + Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913320409 1:117584146-117584168 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
914460328 1:147877868-147877890 GAGGATATGAAAAGTGAGGAAGG + Intergenic
914680464 1:149935226-149935248 GAACAGAGGAAGGATGAGGAGGG + Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915882636 1:159688233-159688255 GAGGAGGGGAAGATTGTGGATGG - Intergenic
916207354 1:162328210-162328232 GAGGAGTCGGAGAGTGGGGAGGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916505902 1:165428140-165428162 GAGGAGAAGAAGTATGTGCATGG - Intronic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
916767284 1:167873607-167873629 GAGTAGACCTAAAATGAGGAAGG - Intronic
916961992 1:169897598-169897620 GAGTAGATGAAGAGTGAAGAGGG - Intergenic
917329561 1:173868084-173868106 GATGAGAGGAAGATTGAGGGAGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917583970 1:176406099-176406121 GAAGAGATGAAGAAAGAGTAGGG - Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
918999881 1:191816729-191816751 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919429529 1:197475366-197475388 GAAGAGAGGAAGGATGAAGATGG - Intronic
919870837 1:201820054-201820076 GAGGAGGAGATGAAAGAGGAGGG + Exonic
919923514 1:202180159-202180181 AAGCAGACGAGGGATGAGGAAGG + Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920413497 1:205781385-205781407 GAGGAGGGGAAGAAAGGGGAGGG + Intergenic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
921254087 1:213323781-213323803 GAGGAGACTATGCATGAGTAGGG - Intergenic
921725539 1:218519470-218519492 GAGAACACGAAGTGTGAGGAAGG + Intergenic
921958369 1:221008085-221008107 GAGGAGGGGAAAAATGGGGATGG - Intergenic
922114526 1:222599051-222599073 GAAGAGAGAAAGAATGATGATGG - Intergenic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922724386 1:227915656-227915678 AAGGAGACGAGGGAAGAGGAAGG - Intergenic
922919826 1:229293156-229293178 TAGGAGACGAGGTATGGGGATGG + Intronic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923474827 1:234322532-234322554 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
923506369 1:234609520-234609542 GAGGAGGCGGAGGAGGAGGAGGG + Exonic
923622170 1:235588095-235588117 GAACAGCGGAAGAATGAGGAAGG - Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
1063717757 10:8545478-8545500 GAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1063929103 10:11011321-11011343 GAGTAGACAGTGAATGAGGAGGG + Intronic
1063942352 10:11143108-11143130 GAGGAGAGGAAGAAGCACGAGGG - Intronic
1064067554 10:12195702-12195724 GAGGAGAAGAAGAAGGGGAAAGG - Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065871697 10:29961246-29961268 GAGGAGGCAGAGAATAAGGAAGG - Intergenic
1065966984 10:30778724-30778746 GAGAAGAAGAAGGATAAGGAGGG + Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066507069 10:36056577-36056599 GAGGAGGGTAAGAAAGAGGATGG + Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067267050 10:44755632-44755654 GAGGAAATGAAGACTTAGGAAGG + Intergenic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069610881 10:69771772-69771794 GAGGAGACTAAGACTCAGCAAGG - Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070809455 10:79290336-79290358 GAGGAGTGGAAGAGAGAGGAAGG - Intronic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071014052 10:80973716-80973738 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1071503935 10:86221885-86221907 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072255548 10:93617043-93617065 GAGGAAAGGAAGAGAGAGGAAGG - Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1072753595 10:98001989-98002011 GAGCAGGGCAAGAATGAGGAAGG + Intronic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1072846814 10:98840602-98840624 GAAGAGACAAAAAATGAGGAGGG + Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073441487 10:103555283-103555305 GAGGAGACGGGGGAGGAGGAGGG + Intronic
1073494377 10:103878411-103878433 GAGTAAACCAAGAATGAGGTAGG - Intergenic
1074026616 10:109642438-109642460 GAGGAGACCAAGAGTGAGACGGG - Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075118838 10:119649827-119649849 GAGGAGGGGAAGGAAGAGGAAGG + Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075970974 10:126652206-126652228 GAAGAGATGAAGCATGAAGAGGG - Intronic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076480540 10:130782533-130782555 GAGGAGACGATGTATGAGAGAGG + Intergenic
1076495178 10:130892605-130892627 GAGGAGAGGGAGGAAGAGGAGGG - Intergenic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077165863 11:1137999-1138021 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1077372050 11:2186956-2186978 GAGGAGACAAAAGATGAGGGCGG + Intergenic
1077564942 11:3291716-3291738 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077570828 11:3337533-3337555 AAGGAGACTAACAGTGAGGATGG - Intergenic
1078355939 11:10631410-10631432 GAGGAGAGGAAGTTTTAGGAAGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080541746 11:33272814-33272836 GAGGGGAGGAAGAAAGAGGGAGG - Intronic
1080556795 11:33424865-33424887 GAGGAGGTGAAGAATGAGGTTGG + Intergenic
1080738101 11:35037112-35037134 GAGGAGCCCAACAAAGAGGATGG - Intergenic
1081154863 11:39677499-39677521 GAGGAGACAGAGAAAGAGAAAGG + Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082671283 11:56039814-56039836 GAGGAACCGAATAATAAGGATGG + Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083411917 11:62499733-62499755 GAGGCCACGTAGAATGATGATGG + Intronic
1083759044 11:64805920-64805942 GAAGAAAGCAAGAATGAGGAGGG + Intronic
1084192794 11:67506409-67506431 GAGGAGACTATGGATGGGGAGGG - Intergenic
1084529275 11:69717501-69717523 GAGGAGAGGAGGGAAGAGGAGGG - Intergenic
1085102614 11:73814282-73814304 CAGAAGACGAAGACTGAGGTGGG + Intronic
1085485708 11:76861127-76861149 GAGGAGACGCCGTGTGAGGAAGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087234087 11:95698842-95698864 GAAGAAACAAAGAAAGAGGAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087578579 11:100023423-100023445 GAGGAGACTGAGAATGTGTAGGG - Intronic
1087730587 11:101774166-101774188 GAGGAGCTGAGGGATGAGGAAGG + Intronic
1088645450 11:111913216-111913238 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1088976851 11:114823375-114823397 GACGGGATGAAGACTGAGGAAGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089596343 11:119583400-119583422 GAAAAGACGAAGCATGAGGCTGG - Intergenic
1089684506 11:120138165-120138187 GAGGAGGCGGAGGAGGAGGAGGG + Exonic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1090043366 11:123310078-123310100 CAGGAGACAAAGAATGAGTTAGG - Intergenic
1090236263 11:125150018-125150040 GAGGAGGGGAAGAACAAGGATGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091879255 12:3963468-3963490 GAGGAGAGGAAAAGTGAGTAGGG + Intergenic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092238714 12:6824877-6824899 GAGGAGAGGAAGATGGATGATGG - Intronic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094234382 12:28146846-28146868 GAGGAGAAGAAGAAAGAAGGAGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095251838 12:39988614-39988636 GAGGAGGGGAAGGAGGAGGAGGG + Intronic
1095253947 12:40011640-40011662 GAGGAGACGGGGAGGGAGGAAGG - Intronic
1095396350 12:41766481-41766503 GAGGAGAGGAAGACACAGGAAGG - Intergenic
1095644444 12:44526738-44526760 GCGGAGCAGAAGAATGGGGAGGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097993775 12:65865017-65865039 GAGGAGGCTGAGGATGAGGAGGG - Intronic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098236146 12:68420201-68420223 GAGGAGAGGAGGAAGGAGGGAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098486850 12:71031491-71031513 GAAGAGGAGAAGATTGAGGAGGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098570444 12:71981921-71981943 GAGGAGACTAAGTCAGAGGATGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099146393 12:79050306-79050328 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1101084893 12:101225921-101225943 GAGGAGGAGAATGATGAGGAGGG - Intergenic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1101901192 12:108792395-108792417 GAGGAGACGGAAAGGGAGGAGGG - Exonic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102278209 12:111598853-111598875 GAGGAGACCGAGGACGAGGACGG + Exonic
1102428077 12:112860235-112860257 GAGAAGACTGAGAATGAGCAGGG - Intronic
1102570238 12:113823063-113823085 GAGGAGACAGGGGATGAGGAAGG - Intronic
1102679817 12:114683870-114683892 GAGCAGAGGAAGGAGGAGGAGGG - Intronic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102856282 12:116297116-116297138 GAGGAGTGGATGAATGAAGAAGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103206917 12:119136956-119136978 GAGGAGATGGAGAAAGAGAAGGG - Intronic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103516208 12:121509928-121509950 GAGGAGGAGAAGGACGAGGAGGG - Exonic
1103841603 12:123869706-123869728 GAGGAGCCTGAGAAGGAGGAAGG - Intronic
1103859726 12:124002706-124002728 GAGATGGGGAAGAATGAGGAAGG + Intronic
1103862171 12:124024220-124024242 GAGGAGATCAGGAATGGGGAAGG - Intronic
1103948174 12:124538468-124538490 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1105544861 13:21343982-21344004 GAGGAGGAGAAGAAGGAGAAGGG - Intergenic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1105907180 13:24823538-24823560 GAAGAGACAGAGAAAGAGGAAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106019871 13:25904386-25904408 GAGGAAACGGAGAATGTCGAAGG - Intronic
1106171618 13:27293471-27293493 GAGGCGGGGAAGAATGAGGAGGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1107906441 13:45065516-45065538 GAAGAGAGGAAGGAAGAGGAAGG - Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1109217460 13:59605790-59605812 GACGGAAGGAAGAATGAGGAAGG + Intergenic
1109243664 13:59925704-59925726 GAGCAGACCAATAATGAGTAAGG - Intronic
1109693863 13:65928104-65928126 GAAGAGAAGTTGAATGAGGAGGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110041291 13:70762383-70762405 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110590114 13:77246602-77246624 GAGGAGGAGAAGAAAGAAGAAGG + Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111995029 13:95157484-95157506 GAAGAAAGGAAGAAAGAGGAAGG + Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113585158 13:111459789-111459811 AAGGAGACGAAGAGAGAGAAGGG + Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113839609 13:113351254-113351276 GAGGAGACGGGCATTGAGGAGGG - Intronic
1114262365 14:21046933-21046955 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1114491103 14:23102515-23102537 GAGGAGAGGAAAACTTAGGAAGG + Intergenic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115275601 14:31605813-31605835 GAGGAGACGAGAAAGGAGAAGGG - Intronic
1115275608 14:31605849-31605871 GAGGAGACAAGGAAGGAGAAGGG - Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115440575 14:33430245-33430267 GAGGAAAAGAAGAATGGGGGAGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116717941 14:48451333-48451355 GAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1119126915 14:72135889-72135911 GAGGAGGGGAAGGAGGAGGAGGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121839015 14:97117430-97117452 GAGGACACCAAGAAGGAGCAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122016785 14:98803276-98803298 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1122077813 14:99246816-99246838 GAGGAGGCCAAGCTTGAGGAGGG + Intronic
1122523131 14:102360859-102360881 GAGGATACTAAGTATGAGGCAGG - Intronic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123154288 14:106209539-106209561 GAGGAGAGGAACAGTGTGGAAGG + Intergenic
1123450865 15:20358161-20358183 GAGGAGAGGAAGGGAGAGGAAGG - Intergenic
1123778552 15:23603730-23603752 GAGAAGAGGAGGAATGAGCACGG + Intronic
1124703873 15:31943977-31943999 GAGCAGACAAATAATGAGTAAGG + Intergenic
1124833044 15:33167871-33167893 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1124956547 15:34364096-34364118 GAGGTGAAGAAGACTGAAGAAGG + Intronic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125086393 15:35735118-35735140 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
1125390427 15:39186612-39186634 GAGCAGAGGAAGAACGGGGAAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126361068 15:47846588-47846610 GAGGAGGAGAAGAAGGAGTAAGG + Intergenic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126750615 15:51873136-51873158 GATGAGATGAAGAGAGAGGAAGG - Intronic
1127123594 15:55791619-55791641 GAGGTGACTAAGCATGAGGGAGG - Intergenic
1127392954 15:58521662-58521684 TAGGAGGGGAAGAAAGAGGAAGG + Intronic
1127935415 15:63632361-63632383 GAAGGGATGAAGAATGAGGCAGG + Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128304157 15:66587034-66587056 GAGGAGGGGGAGAATGGGGAGGG - Intronic
1128466242 15:67914965-67914987 GAGGAGGAAAAGAATAAGGAGGG - Intergenic
1128496144 15:68199738-68199760 GAAGAGACTAAGGATGGGGAGGG - Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128632240 15:69279143-69279165 GAGGAGGCTGAGAATGAGGGAGG - Intergenic
1128704580 15:69829227-69829249 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1129797938 15:78392151-78392173 GAGATGAGGATGAATGAGGATGG - Intergenic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131339528 15:91584158-91584180 GAGGAGGAGAAGGAAGAGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131687677 15:94788157-94788179 GAGGGAAGGAAGAAAGAGGAAGG - Intergenic
1131855802 15:96592606-96592628 GATGAGACTAAGAATGGGTAAGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134948712 16:18342128-18342150 GAGGAGGGGAGGAAGGAGGAGGG + Intergenic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135743660 16:24998001-24998023 GAGAAGACGGAGGCTGAGGATGG + Intronic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1135973761 16:27091581-27091603 GAAGAAAAGAAGAAAGAGGATGG + Intergenic
1136040226 16:27572707-27572729 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1136539925 16:30923571-30923593 GAAGAGAGGAGGAAGGAGGAAGG + Intronic
1136713435 16:32258581-32258603 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136754476 16:32670850-32670872 GATTAGACGAAGAGTGAGGGTGG + Intergenic
1136813637 16:33199515-33199537 GATTAGACGAAGAGTGAGGGTGG - Intronic
1136820113 16:33309595-33309617 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136826676 16:33366134-33366156 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136831742 16:33464905-33464927 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136849718 16:33603189-33603211 GAGGAGAGGAAGGATGGGAAGGG - Intergenic
1137386472 16:48047388-48047410 GAGGAGGGGAAGCAGGAGGAGGG + Intergenic
1137427301 16:48390547-48390569 TAAGACACGATGAATGAGGAAGG - Intronic
1137617498 16:49856230-49856252 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1137881099 16:52049584-52049606 GAGGAGAGGAAGAGTCAAGATGG - Intronic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138153974 16:54685892-54685914 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138480386 16:57298923-57298945 GAGGAGCCAAAGAATGTGGGTGG + Intergenic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1139196238 16:64921624-64921646 GAGGAGGGGAAGGAGGAGGAGGG - Intergenic
1139196268 16:64921795-64921817 GAGGAGGGGAAGGAGGAGGAGGG - Intergenic
1140102731 16:71932450-71932472 GAAGTGACAAAGAATTAGGAAGG - Intronic
1140259056 16:73361634-73361656 AAGGAGACCAAGATTGGGGATGG - Intergenic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141594401 16:85088598-85088620 GATGAGACCAAGAGGGAGGAGGG + Exonic
1141738367 16:85871540-85871562 GAGGAGGGGAGGAAAGAGGAGGG - Intergenic
1141738372 16:85871555-85871577 GAGGAGGGGAGGAAAGAGGAGGG - Intergenic
1202992213 16_KI270728v1_random:22489-22511 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1203056623 16_KI270728v1_random:931181-931203 GATTAGACGAAGAGTGAGGGTGG + Intergenic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143444204 17:6997522-6997544 GAGACGAGGAGGAATGAGGATGG + Intronic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1144229351 17:13184785-13184807 GAGGAGGGGGAGAAAGAGGAGGG + Intergenic
1145912215 17:28549363-28549385 GAGGAGAGGAGGAATAGGGAAGG - Intronic
1146412705 17:32601365-32601387 GAGGAGAGGAAGAGAGATGAGGG + Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1147343946 17:39774375-39774397 GAGGAGAGGAGGGAAGAGGAGGG + Intronic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147649595 17:42054347-42054369 GAGGAGAGGATGAGTGAGGCTGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148339226 17:46863513-46863535 GAGAAGACAAAGAAAGAGGATGG + Intronic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148489014 17:48011525-48011547 GAAGAGACGAAGAGGAAGGAGGG + Intergenic
1148517570 17:48235093-48235115 GAGGAGACAAAGACTGAGCTGGG + Intronic
1148866303 17:50630563-50630585 GAGGAGAGGAAGAGAGAAGAAGG - Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1150131657 17:62672441-62672463 GAGGAGACCAAGAATGCGCCAGG - Intronic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152565126 17:81096954-81096976 GAGGAGGAGAAGAAGGAGAAAGG + Intronic
1153483299 18:5569509-5569531 GATGAGAGGAAGGATGAGAAAGG + Intronic
1153544966 18:6195970-6195992 GAGGGGATGAGGAATGAAGAGGG - Intronic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155548925 18:26944143-26944165 GAGGAGACAAAGAAAGCGCATGG + Intronic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156752709 18:40478901-40478923 GAGAAGACTAGGAAAGAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158087506 18:53670042-53670064 GAGGAAAAGAAGAAAAAGGAGGG - Intergenic
1158425680 18:57337983-57338005 GATGACAGCAAGAATGAGGAAGG - Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159534474 18:69698377-69698399 GAAGAGACGAAGAATGGAGAAGG - Intronic
1159848281 18:73493294-73493316 GAGGAGGAGAAGGAAGAGGACGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161408198 19:4102133-4102155 GAGGATACTAAGAGTGAAGAGGG + Intronic
1161415740 19:4145465-4145487 GAGGTGGGGAAGAAGGAGGAGGG + Intergenic
1161748418 19:6075954-6075976 GAGGAGAGGAAGAAAGCAGAGGG + Intronic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1161803545 19:6429508-6429530 GAGGAGAGGAGGAAGGAGAAAGG + Intronic
1162053054 19:8046701-8046723 GAGGAGGAGAAGGAGGAGGAAGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162516738 19:11152764-11152786 GAGGGGTGGAAGAAGGAGGAGGG + Intronic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164975640 19:32570989-32571011 GAGGAAACAAGGAAGGAGGAAGG - Intergenic
1165428245 19:35757240-35757262 GAGGAAACTAAGGCTGAGGAGGG + Intronic
1165446955 19:35861743-35861765 GAGGGGAGGAAGAAGCAGGAGGG - Intronic
1165927028 19:39333146-39333168 GAAAAGACAAAGAATGAGGCAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166672452 19:44719035-44719057 GAAGAGGAGAAGAAAGAGGAAGG + Intergenic
1166763346 19:45238264-45238286 GAGGAGGCAAAGATTGAGGGTGG + Intronic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1167117801 19:47498216-47498238 GAGGAGACCAGTGATGAGGACGG + Intronic
1167191308 19:47991808-47991830 GAAGAGAGGAAGGAGGAGGAGGG - Intronic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167609892 19:50501936-50501958 GAGGAGGTGATGAAGGAGGAGGG - Intergenic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
925174539 2:1772854-1772876 GAGGAGAGGAAGCATCAGGTGGG + Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926070333 2:9883711-9883733 GAGAAAACCAATAATGAGGATGG + Intronic
926266852 2:11330921-11330943 GAGGAGAGGAGGAGGGAGGAAGG + Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927686588 2:25175319-25175341 TAGGAGGGGATGAATGAGGAAGG + Intergenic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928268281 2:29831105-29831127 GAGGAGAAGAAGAAGAAGAAGGG + Intronic
928320566 2:30279978-30280000 GAGGAGAAGAAGAAGAAGAATGG - Intronic
929133696 2:38602877-38602899 GCGGAGACGGAGGAGGAGGAGGG - Exonic
930063824 2:47312272-47312294 GAGAATACGAAAAATAAGGATGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930411621 2:51032161-51032183 GAGGAGGAGAAGGAGGAGGAGGG + Exonic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
932320504 2:70819039-70819061 GAGGAGAGGAAGGGAGAGGAAGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933039033 2:77437866-77437888 GAGGTGAGGAGGAATGAGTAGGG + Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933309042 2:80637748-80637770 GAGAAGTGAAAGAATGAGGAAGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933462601 2:82607730-82607752 GAGGAGAAGAAGGATTGGGATGG - Intergenic
934604279 2:95682439-95682461 GAGGATGCGAAAAAGGAGGAAGG - Intergenic
934751977 2:96799490-96799512 GAGGAAACAAAGGATGAGGCAGG - Intronic
934773155 2:96920874-96920896 GAGGAGCTGAAGACTGGGGAGGG + Intronic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
935230272 2:101090004-101090026 GGGGAGAGGAAGGAAGAGGAGGG + Intronic
935712210 2:105909304-105909326 GAGGACACAGAGAAAGAGGAAGG + Intergenic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936379554 2:111972338-111972360 GAGGACATGAAACATGAGGATGG + Intronic
936536720 2:113317906-113317928 GAGGAGACAAACAATGAGTTTGG - Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
939319744 2:140603527-140603549 GAGAAGATGTAGAATCAGGATGG - Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939428071 2:142066614-142066636 GAGGAGATGAAGAGTGTGGTAGG - Intronic
939773940 2:146360976-146360998 GAGGAGAAGAGGAAAAAGGAGGG + Intergenic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
940894240 2:159064911-159064933 GGGGAGGGGAGGAATGAGGACGG - Intronic
941239779 2:163022820-163022842 GAGGAGAGAAAGAATGGGAATGG - Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941446255 2:165603507-165603529 GAGGAGAGGAAGGAAGTGGAAGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941972448 2:171366147-171366169 GAGGATTCTAGGAATGAGGATGG + Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
945155162 2:206830426-206830448 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
945202765 2:207300066-207300088 GACGAGTAGAAGAATGAAGAAGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
946382091 2:219355648-219355670 GAGGAGGAGAAAAATTAGGATGG - Intergenic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946973693 2:225123427-225123449 GAGGAAATGAAGAAAGAGAAAGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948088239 2:235268132-235268154 GAGGAGAGGAGGGATGGGGAAGG - Intergenic
948347679 2:237312916-237312938 GAAGAGAGGAAGAAGGAGGTGGG - Intergenic
948908811 2:240992848-240992870 GAGGAGACTGCGAATGGGGAAGG - Intronic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1170388036 20:15841738-15841760 GAGGAGACTTAGAATGATGGTGG + Intronic
1170821338 20:19758158-19758180 GAGGAGAGGAAAGAGGAGGAGGG - Intergenic
1171001665 20:21421936-21421958 GAGGAAAGGAAGAAAGAGTAGGG - Intergenic
1171494044 20:25542416-25542438 GAGGAGACCAAGAAGAAGAATGG + Intronic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172044510 20:32070928-32070950 GAGGAGGGGAAGGAGGAGGAGGG + Intronic
1172050263 20:32111838-32111860 GAGGGGCCGAAGCATGATGAGGG + Intronic
1172061458 20:32189956-32189978 GAGGACGCGAACAAGGAGGAGGG - Intergenic
1172486960 20:35304150-35304172 GAGGAGAGGAAGGAAGGGGACGG + Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173427386 20:42954924-42954946 GAGGAGAGGAAGAGGGAGAAGGG + Intronic
1174400901 20:50275272-50275294 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175399325 20:58692040-58692062 GATGAGACGAGGAAGGAGCAGGG - Intronic
1175805161 20:61823560-61823582 GAGGAGACCAAGAATTAAGAAGG + Intronic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178219696 21:30642302-30642324 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179117268 21:38505329-38505351 GAGGGGGCGAGGGATGAGGAGGG - Intronic
1179470100 21:41604751-41604773 GAGGAGACGAGAAAGAAGGAAGG - Intergenic
1179540738 21:42082029-42082051 GAGGAGATGAAGAGTGAGTCAGG + Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181094821 22:20497710-20497732 GTAGAGACGAAGACTGAGTAGGG + Intronic
1181162694 22:20967376-20967398 GAGAAGACCAAGGATGAGAAGGG + Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182043666 22:27258021-27258043 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1182380455 22:29883369-29883391 GAGGAGACGGAGGACGGGGATGG - Intronic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183718055 22:39545825-39545847 GAGGAGACGAAGGACAGGGACGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1185171475 22:49297106-49297128 GAGGAGACGTGGACTCAGGAGGG + Intergenic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949147941 3:726187-726209 GTGGGGACTAAGAATGAGAAAGG + Intergenic
951614664 3:24528838-24528860 GAGAAGACGAACAATGAACACGG + Intergenic
951840145 3:27025613-27025635 GAGAAGAGAAAGCATGAGGAGGG - Intergenic
951954966 3:28243409-28243431 GAGGAGACTGAGAATGAGAGAGG + Intronic
952107585 3:30087736-30087758 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952503078 3:33982291-33982313 GAGTAGGCCAAGAAAGAGGAAGG - Intergenic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
953783939 3:45896535-45896557 GAGGAGACCGAGACTGGGGAAGG + Intronic
953957258 3:47240959-47240981 GAGGAGTTTAAGAATGAGCAAGG - Exonic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956171840 3:66439071-66439093 GAGGAGAGGAAGACAGAGCAGGG + Intronic
956643357 3:71435146-71435168 GAGGAGAGGAAGGAGAAGGAGGG + Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957151461 3:76491326-76491348 GATGAGAGGAAGACTGAGCATGG - Intronic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957234865 3:77574059-77574081 GAATAGACAAAGAATGAGAATGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
957516797 3:81265205-81265227 GAGGAGACAAAGGATATGGAGGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957899926 3:86476169-86476191 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960418334 3:117412670-117412692 GAGAAGAGGAAGAAGGAGAAGGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
960815613 3:121668806-121668828 GAGGAGACTGAGAATTAGTATGG - Intronic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960982734 3:123246430-123246452 GAGCAGTGGAAGAATGAAGAGGG + Intronic
961026837 3:123565706-123565728 GAGTTGAGGAAGAATGAGGCAGG + Intronic
961070715 3:123922676-123922698 GAGCAGACCAATAATGAGTAAGG + Intronic
961345417 3:126260562-126260584 GAGGAGGGGAAGGAGGAGGAGGG - Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962649609 3:137475487-137475509 GAGGAGAGGAAGAGAGAGGGAGG - Intergenic
962911435 3:139855121-139855143 GAGGATAGGAAGAAAGAGAAAGG - Intergenic
963110190 3:141682260-141682282 GAAGAGAGAAAGAAAGAGGAAGG + Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964479400 3:157126941-157126963 GAGCAGTGGAAGAATAAGGAGGG + Intergenic
964535440 3:157716272-157716294 GAGGGGAGGAATAATGAAGATGG + Intergenic
964804742 3:160596348-160596370 CAGGATAGGAACAATGAGGAAGG + Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
966908546 3:184544673-184544695 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
967165003 3:186772657-186772679 GAGCAGACGAAGGAAGAGAAAGG + Intergenic
967395339 3:189002245-189002267 GAGGAGACAAAGCAGGAGGTTGG - Intronic
967470905 3:189861002-189861024 GAGGACTCCAAAAATGAGGAAGG - Intronic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969255285 4:5997108-5997130 GAGAAGTCGAAGGAAGAGGAAGG + Intergenic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970233452 4:13934154-13934176 GAAGAGGCCAAGAATGAGAAAGG + Intergenic
970332849 4:15003112-15003134 GAGGAGGCGGAGGAGGAGGAGGG - Exonic
970645295 4:18113826-18113848 GAGGAGAAGAAGAAGGGGAAGGG + Intergenic
971000000 4:22311304-22311326 GATGGGACGAAGTATGGGGAAGG + Intergenic
971070506 4:23086028-23086050 GAGGAGAGGAAGGTAGAGGAGGG + Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971445731 4:26746107-26746129 GAAGAAAAGAAGAATGAGTATGG - Intronic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
972300980 4:37785390-37785412 TAGGAGAGGAAGAATTAGCAGGG + Intergenic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973919186 4:55667354-55667376 GAGGAGACAAGGAAAGAGGAAGG + Intergenic
974229244 4:59088853-59088875 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
974229267 4:59088924-59088946 GAGGAGGGGAAGGAGGAGGAGGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975443927 4:74441043-74441065 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
975902004 4:79164417-79164439 GAGCAGACAAACATTGAGGACGG + Intergenic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976512757 4:85930157-85930179 GGGGAGACGGAGCAGGAGGAGGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
976777179 4:88719570-88719592 GAGGAGGAGAAGAAGGAGAAAGG - Intergenic
977286357 4:95112221-95112243 GATGAGATGAAGAATCATGAAGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
978346755 4:107777998-107778020 GAGGAGAGGAAAAGAGAGGAGGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978863764 4:113482374-113482396 GAGGAGACAAAGAAAGACTAAGG + Intronic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980142593 4:128938580-128938602 GAGGAGATGAAGATTAAGGAAGG - Intronic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981330986 4:143510083-143510105 GAGGAACCAAAGAAGGAGGAGGG - Intergenic
981498716 4:145423119-145423141 GAGGAGGAGAAGAAAGGGGAGGG + Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982364369 4:154559185-154559207 GAGGAGAAGAAGAAGGGGAAGGG - Intergenic
982754103 4:159198391-159198413 GAAGAGAGGAAGAGAGAGGAAGG - Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983643504 4:169966252-169966274 GAGAAGATGAAGGATGAAGATGG + Intergenic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983713508 4:170749257-170749279 GAGGAGACGAGGGGAGAGGAGGG - Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984156291 4:176199202-176199224 GAGGAGACGGAGGAAGAGGAGGG - Intergenic
984273242 4:177574026-177574048 GAGGAAAAGAAGAATTGGGAAGG - Intergenic
984333133 4:178352969-178352991 GAGGAGAGGAAGAATGACCTAGG - Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985189384 4:187355288-187355310 GATGAGAATAAGAATGAGAACGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
986516235 5:8566853-8566875 GAGCAGATAAAGAATGACGAGGG - Intergenic
986834332 5:11618048-11618070 GAGGAGGCAGAGAATGATGAAGG - Intronic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
987211973 5:15692834-15692856 GAAGATGTGAAGAATGAGGAAGG + Intronic
987353221 5:17039920-17039942 GAGGAGGAGAAGGAGGAGGATGG - Intergenic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988962551 5:36384481-36384503 GAGGAGACCAAGACTGAAGCAGG + Intergenic
989476487 5:41880240-41880262 GAGGAGATGAAGACTGAACAAGG + Intergenic
989552983 5:42757284-42757306 GAGGTGAGGAGGAAAGAGGAGGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990398290 5:55407689-55407711 GAGGCAACGAATAATCAGGAGGG - Intronic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990869225 5:60413446-60413468 GATGAGAGGAGGAAGGAGGAAGG + Intronic
991368795 5:65896524-65896546 GAGGGGATGATGAATGGGGATGG + Intergenic
991927432 5:71719191-71719213 GAGGAGGCGAAGAAGGAAGGGGG - Exonic
992022114 5:72634984-72635006 GAGGAGATGAAGATTGGGGTAGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
994167838 5:96626447-96626469 GAGGGCAGGAGGAATGAGGATGG - Intronic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995026783 5:107432874-107432896 GAGTAGACTGAGGATGAGGAGGG - Intronic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995054369 5:107743071-107743093 GAGGACAGAAAGAATGAGAATGG + Intergenic
995118227 5:108505964-108505986 GAGGAGAGGAGGAGAGAGGAGGG - Intergenic
995160336 5:108972432-108972454 AAGGAGACTAATAATGAAGATGG - Intronic
995414621 5:111895275-111895297 GAGGAGATGAGGAACGGGGAAGG + Intronic
996045800 5:118872528-118872550 GAGAAGAGGAAGAAAGAGAAAGG + Intronic
996367873 5:122722024-122722046 GAGGAAGGGAAGAATGAGAAAGG - Intergenic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
996508736 5:124295749-124295771 GGAGAGAGGAAGAATGATGAGGG - Intergenic
996862107 5:128079647-128079669 GAGAAGAGGAAGAATAAGCATGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997162495 5:131623985-131624007 GAGGAGTGGAAAAGTGAGGAAGG + Intronic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999582494 5:153054946-153054968 GAGGGAACGAAGAATGATCAAGG - Intergenic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000548714 5:162633252-162633274 GAGCAGAGGAAGAGTGAGAAAGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000847551 5:166300367-166300389 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003418286 6:5932826-5932848 GAGGCTGGGAAGAATGAGGAAGG + Intergenic
1004005296 6:11632531-11632553 GGGGAGAACATGAATGAGGATGG - Intergenic
1004320166 6:14625899-14625921 GGGGAGAGGAAGAAGGAGAAGGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004405314 6:15327618-15327640 GAGAGGACTAAGAATGAGGGAGG + Intronic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1005081912 6:21965276-21965298 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005081918 6:21965291-21965313 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005081924 6:21965306-21965328 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081929 6:21965321-21965343 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081934 6:21965336-21965358 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081939 6:21965351-21965373 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081944 6:21965366-21965388 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081949 6:21965381-21965403 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005210255 6:23452480-23452502 CAGGAGACGAAGGTTGAGCATGG - Intergenic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1005914216 6:30338441-30338463 GAGGAGATGGAGAAAGATGAGGG + Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006976939 6:38111524-38111546 GAGGAGACGAAGGAGGAGTGGGG - Intronic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007925045 6:45643644-45643666 GAGAAGGCGAGGAAGGAGGAGGG - Intronic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008225014 6:48904446-48904468 GAGGAGAAGAAGAAGTAGAAGGG - Intergenic
1008518871 6:52344193-52344215 GAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010091883 6:71992488-71992510 GAGGAGAAGAAGAAAAAGAAGGG - Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1011083317 6:83512393-83512415 GAGGAGACGGAGAGGGAGGGCGG - Intergenic
1011254390 6:85405892-85405914 GAGTAGGGGGAGAATGAGGATGG - Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012092814 6:94920229-94920251 GAGGAGAGGAAGAAACATGATGG - Intergenic
1012325973 6:97917969-97917991 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1013609187 6:111778251-111778273 GAAGAAAAGATGAATGAGGAAGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013687271 6:112600275-112600297 CAAGTGACGTAGAATGAGGAAGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014704854 6:124733159-124733181 GAGGAGAGGAAGGTTGAGTAGGG + Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1015590611 6:134819334-134819356 GAGGAGATGAAGAAAAATGAGGG - Intergenic
1015699469 6:136019899-136019921 GAGGAGAGGGAGGAAGAGGAAGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1017275352 6:152560405-152560427 GAGCAGGCCAATAATGAGGAAGG + Intronic
1017605498 6:156128304-156128326 GAGAAGGCGAAGAAGGTGGAGGG + Intergenic
1017805716 6:157943763-157943785 GAGGAGCCAAAGAATAAGAAAGG - Exonic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018928786 6:168225898-168225920 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1019535282 7:1526141-1526163 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535306 7:1526228-1526250 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1019964095 7:4484759-4484781 GAGAGGAGGAAGAGTGAGGAGGG + Intergenic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020515822 7:9117691-9117713 GAGGAGACAAAGGATAAGAAAGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020733910 7:11921460-11921482 GAGCAGACCAATAATGAGTAAGG + Intergenic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1021116115 7:16748099-16748121 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1021280732 7:18714653-18714675 CAAGAGATGAAGAATGAGAAGGG - Intronic
1021410156 7:20320933-20320955 GATGAGAAGAAGAATGAAGTAGG + Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022012791 7:26323519-26323541 GAGGAGAGGAAGAGAGTGGAAGG + Intronic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022208746 7:28187747-28187769 GAGGATACTGAGAATCAGGATGG + Intergenic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023026342 7:36053865-36053887 GAGGAGAAGAAGAATGTAGGAGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023412172 7:39899043-39899065 GAGGAGGAGAAGTAGGAGGAGGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026110546 7:67455695-67455717 GAGAAGAGAAAGAAAGAGGAAGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026191905 7:68136490-68136512 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1026536266 7:71241202-71241224 GAGGAGAGAAAGAGTGAGAAAGG - Intronic
1026837677 7:73649262-73649284 GAGGAGAGGAAGAGAGAGGGGGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028618880 7:92801920-92801942 GAGGAGACGAAAAGAGAGGCGGG - Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1029477723 7:100794910-100794932 GAGGAGAGGAAGGGAGAGGAGGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1031014250 7:116555637-116555659 GAGGAGAGAAAGAAAAAGGAAGG + Intronic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031108005 7:117569252-117569274 GAGGAGACTAAGAGCCAGGAGGG + Intronic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031802414 7:126264849-126264871 GGTGAGTCCAAGAATGAGGAAGG + Intergenic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1032439768 7:131933426-131933448 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032523515 7:132562972-132562994 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523545 7:132563110-132563132 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032564182 7:132924185-132924207 GATGAGACTAGGAATGAGAAAGG + Intronic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033586702 7:142779674-142779696 GAGGAGAGGAAGCAGAAGGAGGG - Intergenic
1033619860 7:143052423-143052445 GAGAAGATAAAGCATGAGGAAGG - Exonic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1034951266 7:155298206-155298228 GAAGAGACAAAGAGCGAGGAAGG - Intronic
1035226726 7:157438017-157438039 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035226746 7:157438076-157438098 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035274950 7:157742533-157742555 GAGTAAACGATGAATGTGGATGG + Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036657050 8:10683451-10683473 GAGGGGACAAGGTATGAGGATGG + Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1037071541 8:14656392-14656414 GAGGAGAGGAGGAAAGAGAAAGG - Intronic
1037432097 8:18824420-18824442 GAGGAAACTAAGGATGAGAAAGG - Intronic
1037714019 8:21381743-21381765 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1038825186 8:30991600-30991622 GAAGAGAGGAGGAAAGAGGAGGG - Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039689900 8:39852088-39852110 GAGCAGACGAAGCAAGAGAAAGG - Intergenic
1039751888 8:40486294-40486316 GAGAAGAGGAAGGAAGAGGAGGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039884400 8:41646960-41646982 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041106711 8:54452017-54452039 GAGGAGATTAAGATTGAGAAAGG - Intergenic
1041125663 8:54635967-54635989 GAGGAGAGGAAGAGGGAGAAAGG - Intergenic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041167190 8:55102054-55102076 GAGGAGAGGAAGCGGGAGGAGGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041437422 8:57858005-57858027 GAGGAGAGGAAGAAAGAAAAGGG - Intergenic
1041846039 8:62330205-62330227 GGGGTGATGAATAATGAGGATGG + Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042093646 8:65188024-65188046 GGGGAGAGGAAGACTGAAGAGGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042668373 8:71232585-71232607 GAGGAGCCCATGAATAAGGATGG + Intronic
1042889334 8:73589966-73589988 GAAGGGAAGAAGAAAGAGGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1045478040 8:102569672-102569694 GAGGAGAGGAAAAGAGAGGAGGG - Intergenic
1045674058 8:104588923-104588945 GAGGAGACGGAGGAGGAGGGAGG + Exonic
1045948552 8:107825754-107825776 GAGGAGAGGGAGAAAGATGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047299860 8:123604415-123604437 GAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1047530921 8:125674580-125674602 GAGGAGAAGATGTATGAAGATGG - Intergenic
1047776502 8:128075547-128075569 GAGGAGACAAGGATTGAAGATGG - Intergenic
1047887550 8:129268565-129268587 GAGGAAATGAAGAATGAAAAAGG - Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048290488 8:133177697-133177719 GAGGAGAGGGAGGATGAAGAAGG - Intergenic
1049014104 8:139907518-139907540 GAGGAGAGGGAGAAAGAGAAAGG + Intronic
1049454853 8:142681637-142681659 GAGGAGTGGAAGATGGAGGATGG - Intronic
1050122421 9:2321149-2321171 GAGTAGAGGGAGAATGAGAAGGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050475942 9:6041107-6041129 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1050767815 9:9157584-9157606 AAAGAGACCAAAAATGAGGAAGG + Intronic
1051318093 9:15865506-15865528 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052442040 9:28510499-28510521 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1052478073 9:28987218-28987240 GAACAGACCAATAATGAGGAAGG - Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1053022802 9:34707704-34707726 GAGGAGAAGAAGAAGAAGAAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1054706313 9:68466030-68466052 CAAGAGACAAAGAATGGGGAAGG - Intronic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055269207 9:74537181-74537203 GAGGTAACGATGAATGATGAAGG - Intronic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056868751 9:90256474-90256496 GAGGAGGTGAAGGAGGAGGAGGG + Intergenic
1056948997 9:91026887-91026909 GAGGAGCCAAAGAAGGAGGTGGG - Intergenic
1057791849 9:98129896-98129918 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1057896456 9:98912781-98912803 GAGGAGAAGAAGGTAGAGGAGGG + Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058568451 9:106312800-106312822 GAGAAAATGAAGAATGAGAAGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058717523 9:107736340-107736362 GATGAGACCAAGGATGAGGGTGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060727559 9:126016416-126016438 GAGGAGACGGCAGATGAGGAAGG + Intergenic
1060816724 9:126639029-126639051 GAGGAGAGGAGGAAAGGGGAGGG + Intronic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061405795 9:130392368-130392390 CAGGAGACGAGGCCTGAGGACGG + Intronic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062176728 9:135167560-135167582 GATGACAGGAAGAATGAAGAAGG + Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185432778 X:19150-19172 GAGCAGACGGAGAGTGACGAAGG + Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185534416 X:849484-849506 AAGGAAACAAAGAAAGAGGAAGG - Intergenic
1185535127 X:854999-855021 GAGGAGAAGAAGACAGAGAAAGG - Intergenic
1185540500 X:899418-899440 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186222023 X:7359413-7359435 GAGGAAAGGAAAAATGAGAATGG + Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1186788036 X:12971588-12971610 GAAGAGAAGAAGGAAGAGGAGGG - Intergenic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1187829380 X:23365494-23365516 GGGGAGAGAAAGAAAGAGGAAGG + Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189214872 X:39314337-39314359 GAAGAGAGGAAGAAAGAGAAGGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190260396 X:48793533-48793555 GAGGAGAGGAAGGAGGAGGGCGG - Intronic
1190452908 X:50598553-50598575 GAGAAGACAAAGGATGAGAATGG + Intronic
1191871149 X:65746688-65746710 GAGGTGAGGAAGATTGAGGGAGG - Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192183634 X:68931345-68931367 GAGGAGAGGAAGAAAGATGCAGG + Intergenic
1192185052 X:68941000-68941022 GAGGGGAGGAAGGGTGAGGAGGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192315196 X:70045796-70045818 GAGTAAACCAAGAAAGAGGAAGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193414174 X:81201858-81201880 GAGGAGAAGAAGAAAGAAAAAGG - Exonic
1193471768 X:81913205-81913227 GTGGAGATGAAGAATGAGTTAGG - Intergenic
1194740072 X:97562182-97562204 GAGGAGACTGAGAATTAGAAAGG + Intronic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195664336 X:107415207-107415229 GAGGAGGTGGAGGATGAGGAGGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196087561 X:111701375-111701397 GAACAGACCAATAATGAGGAAGG - Intronic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197129225 X:122985121-122985143 GAGTAGACTAAGGAGGAGGAGGG + Intergenic
1197140433 X:123111826-123111848 GAAGAGAAGAATAATGATGAGGG - Intergenic
1197176441 X:123491155-123491177 GAGGAGACAAAGAATGGGAATGG - Intergenic
1197457601 X:126697206-126697228 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198533497 X:137566481-137566503 GAGGAGGGGAAGAAAGAGCAGGG - Exonic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1199029684 X:142982065-142982087 GGGGACAGGAAGAATGGGGAGGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200692078 Y:6316450-6316472 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1200713636 Y:6512489-6512511 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201020291 Y:9649552-9649574 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1201043194 Y:9858277-9858299 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201348694 Y:13014839-13014861 GAGCAGACCAAAAATGAGGAAGG - Intergenic
1201461755 Y:14233116-14233138 GAGGAGACGAAGAAGAACAAGGG - Intergenic
1201590384 Y:15608521-15608543 GAAGAAAGGAAAAATGAGGATGG + Intergenic
1201793094 Y:17864011-17864033 GAGGAGACCTAGAAAGAAGAGGG + Intergenic
1201808460 Y:18041975-18041997 GAGGAGACCTAGAAAGAAGAGGG - Intergenic
1202354627 Y:24033255-24033277 GAGGAGACCTAGAAAGAAGAGGG + Intergenic
1202516151 Y:25636857-25636879 GAGGAGACCTAGAAAGAAGAGGG - Intergenic