ID: 1014569930

View in Genome Browser
Species Human (GRCh38)
Location 6:122996450-122996472
Sequence CTCCCGAAGGCGAAAATGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014569920_1014569930 12 Left 1014569920 6:122996415-122996437 CCATCCAGGCGTTCGCGTCCTCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569922_1014569930 -6 Left 1014569922 6:122996433-122996455 CCTCCTCCCCACCTTCTCTCCCG 0: 1
1: 2
2: 21
3: 202
4: 2004
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569921_1014569930 8 Left 1014569921 6:122996419-122996441 CCAGGCGTTCGCGTCCTCCTCCC 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569916_1014569930 27 Left 1014569916 6:122996400-122996422 CCCGAGTGGCCTTCTCCATCCAG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569915_1014569930 30 Left 1014569915 6:122996397-122996419 CCGCCCGAGTGGCCTTCTCCATC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569917_1014569930 26 Left 1014569917 6:122996401-122996423 CCGAGTGGCCTTCTCCATCCAGG 0: 1
1: 0
2: 1
3: 24
4: 216
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569919_1014569930 18 Left 1014569919 6:122996409-122996431 CCTTCTCCATCCAGGCGTTCGCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1014569923_1014569930 -9 Left 1014569923 6:122996436-122996458 CCTCCCCACCTTCTCTCCCGAAG 0: 1
1: 0
2: 3
3: 69
4: 491
Right 1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014569930 Original CRISPR CTCCCGAAGGCGAAAATGGC AGG Exonic
903282289 1:22256913-22256935 CACCCTAAGGGAAAAATGGCTGG - Intergenic
912184970 1:107264334-107264356 CTCCACAAAGCAAAAATGGCAGG - Intronic
916143080 1:161716497-161716519 CTCCTGGAGGAGAAAAGGGCTGG - Intergenic
918314460 1:183311493-183311515 CTCCTGAAAGTGAAAATGGTGGG + Intronic
920096161 1:203487806-203487828 CTCCCGAGGGTGGAAATGGCTGG - Exonic
1064273593 10:13886687-13886709 CTCCAGGAGGCTAAAATGGGAGG - Intronic
1077919594 11:6632554-6632576 CACCCGTAGTCGAAAGTGGCTGG + Exonic
1087297005 11:96389611-96389633 CTCCCCAAGGCGGAAATAACGGG + Intronic
1091290921 11:134439399-134439421 CTCCAGAAGGCGCAGAAGGCAGG - Intergenic
1095267373 12:40175902-40175924 ATTCAGAAGGCGAAAATGTCAGG + Intergenic
1096485197 12:51975623-51975645 TTCCCGAAGGTGACAAAGGCTGG + Intronic
1102495185 12:113314694-113314716 TTCCTGAAGGCAAAACTGGCTGG - Intronic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1110540186 13:76699174-76699196 CTGCCTAAGGCAAAAATCGCAGG - Intergenic
1111387029 13:87540404-87540426 CTTCCAAAGGCGAAAAAGTCTGG + Intergenic
1121186774 14:91979516-91979538 ATCCTTAAGGCGAAAATGACAGG + Intronic
1124546249 15:30629565-30629587 CTCCTGAAGGCAAAAATGACAGG - Intronic
1124779780 15:32618963-32618985 CTCCTGAAGGCAAAAATGACAGG - Intronic
1125368376 15:38943222-38943244 CTCCCTAAGGCTAAGATAGCTGG - Intergenic
1126205299 15:46038500-46038522 CTCCCTATGGGGAAAATGGGTGG - Intergenic
1129408086 15:75332709-75332731 CTTCGGAAGGCCAAAGTGGCGGG - Intergenic
1131681175 15:94725393-94725415 CTCCAGAGTGAGAAAATGGCAGG + Intergenic
1133456202 16:5944627-5944649 CTTCCAAAGGTGACAATGGCGGG - Intergenic
1135570102 16:23542702-23542724 CACCAGAAGGCGAGAATGACTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG + Intronic
929631812 2:43470603-43470625 CTCACGAATGAGAAAATGACAGG + Intronic
935112331 2:100104844-100104866 CTCCCGGAGGAGAAAGAGGCGGG - Intronic
938726320 2:134111668-134111690 TTCAAGAAGGCGAAAATGGAAGG - Intergenic
939852665 2:147319448-147319470 ATCCAGCAGGCCAAAATGGCGGG + Intergenic
944295622 2:198059087-198059109 ATCCAGAAGGAGCAAATGGCAGG - Intronic
947392454 2:229653206-229653228 CTCCCAAAGCCAGAAATGGCTGG - Intronic
1169189870 20:3651772-3651794 CTCCTGTAGGGGAAGATGGCAGG + Intergenic
1173554327 20:43954759-43954781 CTCCCAGAGGCTGAAATGGCAGG - Intronic
1175523341 20:59617061-59617083 CTCCCCAAGTAGAAAAGGGCTGG - Intronic
1175785581 20:61709747-61709769 CTCACGAAGCCCAAAATAGCAGG + Intronic
1177507042 21:22032874-22032896 CTCCATAAGGCCAAACTGGCTGG + Intergenic
1178151689 21:29802018-29802040 CTCCCTGAGGCAAAAATGGATGG + Intronic
1184229383 22:43150615-43150637 CTCACAAAGGCAAAAATGCCAGG + Intergenic
949970078 3:9397052-9397074 CTCCCGACGGCGTAACTGACAGG + Intergenic
951287040 3:20825646-20825668 CTCCGGAAGGCTAAAATGGAAGG - Intergenic
961650111 3:128413033-128413055 CTCCTGAAGGAGCCAATGGCAGG + Intergenic
961868532 3:129971974-129971996 CTCCTGAAGGGTAAGATGGCTGG - Intergenic
963929544 3:150989311-150989333 CTTCCAAAGGAGTAAATGGCTGG - Intergenic
980993444 4:139758607-139758629 CTCCTGCAGCCGAACATGGCTGG - Intronic
985010393 4:185576527-185576549 CTTCCGAAGGCCAAAAGGCCAGG + Intergenic
986579619 5:9251813-9251835 CTCCTGATGGGGAAGATGGCTGG + Intronic
999342769 5:150787144-150787166 CTCCGGTAGGGGAAAATGACAGG + Intronic
1011954119 6:93004134-93004156 CTCTCCAAGGAGAAACTGGCAGG + Intergenic
1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG + Exonic
1018040555 6:159918171-159918193 GTCCTGGAGGAGAAAATGGCTGG - Intergenic
1019870719 7:3758232-3758254 CTGCCGAATGCTAAAATGGGTGG - Intronic
1020281444 7:6652283-6652305 CTCCTGAAGGTGACAAAGGCAGG - Exonic
1026529790 7:71186836-71186858 TTCCCTAAGGCGAGAAAGGCTGG + Intronic
1029276718 7:99409456-99409478 CTCTCGGAGGTGAAAATGGTAGG - Intronic
1029665875 7:101994679-101994701 TTCCCGAAGGTGACAATGGAGGG - Intronic
1039635114 8:39156386-39156408 CTCTGGAAGGCCAAAATGGGAGG - Intronic
1058919614 9:109600388-109600410 CTCCCACAGGCCAAAATGTCTGG - Intergenic
1187295855 X:17999857-17999879 CTCCAGAAGGAGGAAAAGGCAGG - Intergenic
1193162899 X:78247727-78247749 TTCCAGAAGGGGAAAATGGGTGG + Intergenic
1202018228 Y:20434699-20434721 CTGCAGAGGGCCAAAATGGCAGG + Intergenic