ID: 1014571071

View in Genome Browser
Species Human (GRCh38)
Location 6:123008743-123008765
Sequence CTATAAACACAGGCATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014571071_1014571081 28 Left 1014571071 6:123008743-123008765 CCTTCCAATGCCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 11
4: 179
Right 1014571081 6:123008794-123008816 ATTATGTTTAAAATGGAGGTAGG 0: 1
1: 0
2: 4
3: 58
4: 481
1014571071_1014571076 3 Left 1014571071 6:123008743-123008765 CCTTCCAATGCCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 11
4: 179
Right 1014571076 6:123008769-123008791 TCAGGTCCTGACAGTGTGTCAGG 0: 1
1: 0
2: 0
3: 28
4: 165
1014571071_1014571079 24 Left 1014571071 6:123008743-123008765 CCTTCCAATGCCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 11
4: 179
Right 1014571079 6:123008790-123008812 GGCCATTATGTTTAAAATGGAGG No data
1014571071_1014571078 21 Left 1014571071 6:123008743-123008765 CCTTCCAATGCCTGTGTTTATAG 0: 1
1: 0
2: 2
3: 11
4: 179
Right 1014571078 6:123008787-123008809 TCAGGCCATTATGTTTAAAATGG 0: 1
1: 0
2: 1
3: 13
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014571071 Original CRISPR CTATAAACACAGGCATTGGA AGG (reversed) Intronic
902328988 1:15721278-15721300 TTAGAAACACAGGCAGTGGAAGG - Intronic
904452337 1:30621841-30621863 CTACAAACACAGGGAGTGGGTGG + Intergenic
905765196 1:40594854-40594876 CTGTAACCCCAGGCTTTGGAAGG + Intergenic
907492718 1:54819101-54819123 CTAGAGACACTGGCATTTGAGGG - Intronic
915119483 1:153619900-153619922 CTATAAGCACTGCCAGTGGAAGG + Intronic
915518826 1:156429650-156429672 CTGCCCACACAGGCATTGGAAGG - Intronic
916461998 1:165034821-165034843 CTATCAAGACAGGCAGAGGAGGG + Intergenic
919058427 1:192599979-192600001 GTATAATCACAGGGCTTGGAAGG - Intergenic
921975391 1:221197153-221197175 CTATAAACAGATGCATAGGGGGG - Intergenic
922111720 1:222565151-222565173 TTAAAAACACTGGCATTTGAAGG - Intronic
924174210 1:241373275-241373297 TTATAAATACAGGCCTTTGAGGG - Intergenic
1063481804 10:6382937-6382959 ATATAAACACAGGTGTGGGAGGG + Intergenic
1071477569 10:86037838-86037860 CTATAAATACTGCCATTGTATGG + Intronic
1072454812 10:95566534-95566556 CTATAAACACTGGCTCTGGCTGG + Intergenic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1077033872 11:484485-484507 CTGTAAACACAGCCAGTGCAGGG + Intronic
1078013615 11:7593330-7593352 CTAAAAACATAGGCATTGGAAGG - Intronic
1079735179 11:23988456-23988478 CTCTAAACCCAGGTAGTGGAAGG + Intergenic
1081483312 11:43508277-43508299 CTTTAAACACAGGAAGGGGAGGG + Intergenic
1088028733 11:105219781-105219803 CTATAAATACAGACATTAGCTGG + Intergenic
1089195782 11:116693329-116693351 CAAGAAGCACAGGCATTGGTGGG + Intergenic
1089892209 11:121892856-121892878 CTATAAAAACAGTCTTGGGAAGG - Intergenic
1091496191 12:974910-974932 CTGTAACCACAGGTGTTGGAAGG - Intronic
1092789179 12:12057188-12057210 CAATAAACAAAGGCATTCCACGG + Intronic
1093557358 12:20492140-20492162 CTAAAAACACAAGAATTGGCTGG - Intronic
1094285607 12:28789692-28789714 CTCTAAACTCAGGCTTTAGAAGG - Intergenic
1094337613 12:29378241-29378263 CTACAAACCCAGGCATAGCAAGG + Intronic
1094808208 12:34110477-34110499 CTATAAACGGACGCATTGGGGGG + Intergenic
1095380835 12:41589550-41589572 CTATAAAAACATGCATTAGCAGG - Intergenic
1097391564 12:59021344-59021366 CAATGAACAGAGGGATTGGAGGG - Intergenic
1098545997 12:71711638-71711660 CTATAACCCCAGCCATTGGGAGG + Intergenic
1098729992 12:74023921-74023943 CAATTCACACTGGCATTGGAAGG - Intergenic
1102387010 12:112518624-112518646 CTCTAAAGACAGGAATTAGATGG - Intergenic
1111101220 13:83589552-83589574 CAATAACAACAGGCATTTGATGG + Intergenic
1111104490 13:83628051-83628073 CTTTAAACTCAAGCATTTGATGG + Intergenic
1111349188 13:87003842-87003864 CTATGAAAACAGGCTGTGGAAGG - Intergenic
1112488264 13:99839359-99839381 GTGTAAACACAGCCACTGGATGG - Intronic
1117762579 14:59046582-59046604 CAACTTACACAGGCATTGGATGG + Intergenic
1118774673 14:68966386-68966408 CTATAAACCGAGAAATTGGATGG - Intronic
1120142840 14:80947636-80947658 CTATAAACAAATGATTTGGAAGG + Intronic
1121364757 14:93299081-93299103 AAATAAACACAGACCTTGGAAGG + Intronic
1121977357 14:98417579-98417601 TTCTAAACACAGGTATGGGAGGG - Intergenic
1124824727 15:33082479-33082501 CTATAAACAAAGACATGGGTGGG - Intronic
1127201515 15:56658305-56658327 CTATAAACACATAAATTGTATGG + Intronic
1127622804 15:60750865-60750887 CCATAAACACAGTCATCTGAGGG + Intronic
1128250243 15:66158794-66158816 CTATGGAAACAGGCCTTGGAAGG - Intronic
1128895341 15:71367789-71367811 CTATATACACAGTAATGGGATGG + Intronic
1129521632 15:76189956-76189978 CTATAGACACTGACATTGGGAGG + Intronic
1130576935 15:85101404-85101426 CAATAAAAACAGGCATAGAAGGG + Intronic
1131408840 15:92189061-92189083 CAAGAAACACAAGTATTGGAGGG + Intergenic
1131580601 15:93639194-93639216 ATATTAACACAGGTATTTGAGGG - Intergenic
1133336913 16:5012258-5012280 GAATAGACACAGGCATTGGAAGG + Intronic
1135244518 16:20844066-20844088 CTATAAATACAGGCTGTGGTAGG - Intronic
1136391333 16:29966556-29966578 CTATAATCCCAGCCTTTGGAAGG + Intronic
1139349973 16:66328770-66328792 CTAGAAACAGAGGCTTTGGCAGG + Intergenic
1140707195 16:77641782-77641804 CTGGAAATATAGGCATTGGAGGG - Intergenic
1140999254 16:80292520-80292542 CTATTAACTCAGACATTAGAAGG - Intergenic
1141534917 16:84672630-84672652 TTGTAAACACACGCATTGGCAGG - Intergenic
1141606992 16:85159410-85159432 CTAAAAATTCAGGCTTTGGAAGG + Intergenic
1146769855 17:35558912-35558934 CTATAAACACAAACATAGGCTGG + Intergenic
1149388253 17:56163766-56163788 TAATATTCACAGGCATTGGAAGG - Intronic
1151528518 17:74688251-74688273 CTGTAAACAAAGGAATTGGCCGG + Intronic
1152944189 17:83190222-83190244 CAAGGAACACAGGCATTTGAGGG + Intergenic
1154478895 18:14797209-14797231 CTATAAACAGACGCATGGGGGGG - Intronic
1155585513 18:27359510-27359532 CCACAAACACAAGCATAGGAAGG + Intergenic
1157791095 18:50531924-50531946 CTCCTAACACAGGCAGTGGAAGG - Intergenic
1160059124 18:75513860-75513882 CTGCAAACACAGGCATTTGGAGG + Intergenic
1160448170 18:78943203-78943225 CTATAAACCCAGGCATTTCCCGG + Intergenic
1160869874 19:1272467-1272489 TTAAACACACAGCCATTGGAAGG - Exonic
1161137965 19:2631694-2631716 TTATAAAAACAGGAAGTGGAGGG + Intronic
1162179063 19:8854673-8854695 CAGTGCACACAGGCATTGGAAGG + Intronic
1162491983 19:10998141-10998163 CTATAATCACAGCCTTTGGAAGG - Intronic
1164014321 19:21239256-21239278 TTATAAAAACAGAAATTGGAAGG + Intronic
1164031462 19:21409894-21409916 TTATAAAAACAGAAATTGGAAGG - Intronic
1165716634 19:38049967-38049989 CAGTCAGCACAGGCATTGGAAGG + Intronic
928567346 2:32566608-32566630 CTATAATCCCAGGATTTGGAAGG - Intronic
931007242 2:57865746-57865768 CTCTAAACAAAGGGTTTGGAAGG - Intergenic
931760040 2:65408516-65408538 TTATACATACAGACATTGGAAGG - Intronic
933320680 2:80772243-80772265 CTAGAGACACAGGCCTTGAAGGG - Intergenic
939286156 2:140133021-140133043 GTACAAACTCAAGCATTGGAAGG - Intergenic
939333338 2:140791789-140791811 CTATGAACATAGCCATTGAAGGG + Intronic
944764202 2:202848327-202848349 CTATAAAAACAGCAATTGCATGG + Intronic
944779449 2:203002963-203002985 CTATAATCCCAGGCACTGGGAGG + Intronic
947303355 2:228715185-228715207 CTATAAACGGACGCATTGGGGGG - Intergenic
1168805260 20:669004-669026 GAAAAAACACAGGCCTTGGAGGG - Intronic
1168834333 20:867876-867898 TTAAAAACACAGTCATTGGCCGG - Intergenic
1173170056 20:40716539-40716561 CTATGAACACAGGGCTTGGTGGG - Intergenic
1175257562 20:57656429-57656451 CTAGGAACTCAGGCCTTGGATGG - Intronic
1177144879 21:17396778-17396800 CTATCATCACAGTCAATGGAGGG - Intergenic
1178297028 21:31418654-31418676 CTTTAAACACAGGAGTTAGAGGG + Intronic
1178297960 21:31426832-31426854 CTATAAAGACAAGCACTTGAGGG + Intronic
1179587520 21:42383186-42383208 CTATGACCACAGGCTATGGAGGG + Exonic
1181182014 22:21075019-21075041 CTATAACCCCAGGCTTTGGGAGG + Intergenic
1181360008 22:22327206-22327228 ATGAAAACACAGGCATAGGAAGG - Intergenic
1181370029 22:22408654-22408676 ATGAAAACACAGGCATAGGAAGG - Intergenic
1181806602 22:25378514-25378536 CTATAATCCCAGGCTTTGGAAGG - Intronic
1183959731 22:41404183-41404205 CTAGAAGCACAGGCCTTGGGCGG - Intergenic
1184525565 22:45020611-45020633 CTAAAAACACAGGCCTTGGAGGG + Intergenic
951373553 3:21884597-21884619 CTAAAAACACAGGCAATAAATGG + Intronic
952199938 3:31115802-31115824 GTATAAACACAGTAATGGGATGG - Intergenic
953870793 3:46626156-46626178 CTATACACAGAGGCACTGTATGG + Intronic
953872525 3:46639623-46639645 CTACAAAGACAGGCATTGTCTGG - Intergenic
954759949 3:52866806-52866828 CAAAAAACACAGGCGTTGGAAGG + Intronic
956751136 3:72344886-72344908 TTATAAAAACAGGCAGTGGCTGG - Intergenic
958680198 3:97320291-97320313 CTATAAACAGATGCATTTTAAGG + Intronic
959360596 3:105386042-105386064 CTCTAAACTTAGGCATTGGTGGG + Intronic
961000363 3:123370114-123370136 CTATAAAAACAGCCAGTGGGAGG + Intronic
963363739 3:144308514-144308536 CTAAAAACATAGGCTTTGGATGG + Intergenic
963685538 3:148429185-148429207 CTATAAACATTGTCATTGTATGG - Intergenic
964820376 3:160762328-160762350 CTTTAAGCACAGGCATAGGAAGG - Intronic
968440123 4:619206-619228 CTAAAAACACAGAAATTGGTTGG - Intergenic
969152632 4:5183179-5183201 CTTTAAAACCAGGCATTGGCCGG + Intronic
971899608 4:32642374-32642396 CCACAAACACAGGCATGGGAAGG + Intergenic
974582055 4:63815370-63815392 CTATAAAGACTGTAATTGGAAGG - Intergenic
975269436 4:72412977-72412999 GTATATACAAAGGAATTGGATGG - Intronic
977693400 4:99941237-99941259 CTATATACACAGGCAATGTAAGG + Intronic
979752126 4:124291693-124291715 CTATAAACAAATATATTGGAAGG - Intergenic
980394609 4:132193691-132193713 CTATATGCATAGGCTTTGGAAGG - Intergenic
980834464 4:138173894-138173916 CTATAAAAATAGGCATTTGTGGG + Intronic
981873285 4:149511869-149511891 CAATAAACACAGGTTTTTGAGGG - Intergenic
981950679 4:150403180-150403202 CCAGAAACACAGGCAGGGGAGGG + Intronic
987544190 5:19291050-19291072 ACTTAAACACAGGCATTGAATGG + Intergenic
990173648 5:53083105-53083127 CTATACAGACAGGAAATGGATGG + Intronic
992204742 5:74420604-74420626 TTATAAACATAGGCAATTGAGGG - Intergenic
993342041 5:86736701-86736723 CTATAAACACACATATAGGATGG - Intergenic
993807556 5:92430848-92430870 ATATAAATAGAAGCATTGGATGG + Intergenic
994016229 5:94969115-94969137 CTTTAAAAAGAGGAATTGGACGG + Intronic
997939552 5:138144643-138144665 CTATAATCCCAGCCTTTGGAAGG + Intronic
998329803 5:141315193-141315215 CTATAAACTCATGCACTGCACGG - Intergenic
1000494725 5:161967490-161967512 CTGTAATCACAGGGTTTGGAAGG + Intergenic
1001903051 5:175446584-175446606 CTGTAAGCACAGGCACCGGAGGG - Intergenic
1002114209 5:176945644-176945666 CTATAAACAGACGCATGGGTGGG + Intronic
1003183307 6:3810203-3810225 CTATAAACACAGAGCTTGCAAGG - Intergenic
1003349712 6:5304707-5304729 CTATTAACAAAGGCAATGCATGG - Intronic
1007223011 6:40293882-40293904 TAATACACACAGGCATTGGTGGG + Intergenic
1008645114 6:53505827-53505849 CTCCAAACTCAGACATTGGATGG - Exonic
1011528094 6:88288556-88288578 ATATAAAAACATGCGTTGGAGGG - Intergenic
1013263249 6:108468099-108468121 ATATAAAAACAGGCATCTGAAGG - Intronic
1014571071 6:123008743-123008765 CTATAAACACAGGCATTGGAAGG - Intronic
1015228438 6:130885495-130885517 CTCAAACCACAGGTATTGGAAGG + Intronic
1015691132 6:135924913-135924935 CTAAAAACACAAACATTTGAAGG + Intronic
1017619490 6:156281124-156281146 TTATAAGCAGAGGCTTTGGAAGG - Intergenic
1017829915 6:158116902-158116924 TTATAAAAGCATGCATTGGAAGG - Intronic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1023332737 7:39136344-39136366 CTATAAACACTGGAACTGCAAGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023913381 7:44570706-44570728 CTAAAAACACAGGCATTTCTGGG + Intronic
1024395997 7:48867508-48867530 ATGTAAACACACACATTGGATGG - Intergenic
1025483469 7:61016135-61016157 CTATAAACACACTCAATGGTAGG - Intergenic
1026441696 7:70450587-70450609 CCATAAAAACAGGCCTTGCACGG + Intronic
1027679135 7:81197166-81197188 TTATTAGCACAGGCATTGAATGG + Intronic
1027753144 7:82177310-82177332 CTATAACCTTAGGCATTGGTTGG + Intronic
1027820016 7:83030820-83030842 CTATAAACCCAGCCATTGTAAGG - Intronic
1028142664 7:87289861-87289883 CCAGAAACATAGGCACTGGAGGG + Intergenic
1028181792 7:87733133-87733155 CTATAAACAGACGCATGGGGGGG - Intronic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1030635532 7:111944081-111944103 CTCTAAAAACAGGCATTTTATGG - Intronic
1031965174 7:128022709-128022731 CTATTAACACAGTCATGGGGAGG - Intronic
1032649607 7:133863197-133863219 CTATCAACACTGCCATTGCAGGG + Intronic
1032974479 7:137206532-137206554 ATATAAAAACAGGCATTAAAAGG + Intergenic
1033373476 7:140734207-140734229 CTGCAAACACAGGCATAGGTAGG + Intronic
1033706061 7:143885782-143885804 ATATAAACACAGAAATTGTATGG + Intronic
1034809756 7:154121417-154121439 CAATAAAAACAGTAATTGGAAGG - Intronic
1035544979 8:473382-473404 CTCTAAACTCAGGCAGTGTATGG + Intergenic
1036124539 8:6050966-6050988 GAAGAAACACAGGCATTTGAAGG + Intergenic
1036547862 8:9789549-9789571 CTATAATCCCAGGCTTTGGGAGG + Intergenic
1037440941 8:18915307-18915329 CCAAAAACACAGGCAATGAAAGG + Intronic
1037701129 8:21274697-21274719 CTGTTAACACAGGGAGTGGAGGG - Intergenic
1037975303 8:23206010-23206032 ATAGAAACACAGACATTGGCCGG - Intronic
1038789452 8:30655970-30655992 CTAAAAATACAGACATTGGCGGG - Intronic
1040412488 8:47168497-47168519 CTAAAAACAGTGGCCTTGGATGG + Intergenic
1041416836 8:57619900-57619922 ATATAGACACAGTCATTGGGAGG + Intergenic
1042614369 8:70632345-70632367 TTATAAGCACAGACTTTGGAGGG + Intronic
1044208745 8:89523611-89523633 CTAAAAACACAGAAATTTGATGG - Intergenic
1046135368 8:110018806-110018828 CAATATACCCAGGCATTGGGAGG + Intergenic
1048632163 8:136256157-136256179 CTGTACTCACAGGAATTGGAAGG - Intergenic
1050828428 9:9980349-9980371 CTATAATCCCAGGAATTGGGAGG + Intronic
1051762990 9:20489311-20489333 CTATAAACAATGTCATTAGAAGG + Intronic
1051779900 9:20678851-20678873 CTATAAACAGAGGTATGGGCAGG - Intronic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052546543 9:29888339-29888361 CTAGAAACAGTGGCATTTGAAGG + Intergenic
1054405217 9:64756237-64756259 CTATAATCTCAGCCTTTGGAAGG + Intergenic
1054438842 9:65241727-65241749 CTATAATCTCAGCCTTTGGAAGG + Intergenic
1054491562 9:65780219-65780241 CTATAATCTCAGCCTTTGGAAGG - Intergenic
1056811109 9:89764535-89764557 CTATCAACACAGGCATAACAAGG - Intergenic
1057488001 9:95501013-95501035 CTATAAATACAGGAATGGGATGG + Intronic
1061401851 9:130372895-130372917 CTATGGAAACAGGCATGGGATGG + Intronic
1186449794 X:9662518-9662540 CCAAAAAGACAGGCAGTGGAAGG + Intronic
1186564151 X:10644424-10644446 CAATAAAGACAGGGTTTGGAGGG - Intronic
1189637666 X:43028626-43028648 CTATAAACGGACGCATGGGAGGG - Intergenic
1191007045 X:55720727-55720749 CTGTAATCCCAGGCATGGGATGG + Intronic
1195403889 X:104491973-104491995 ATATAAACAGATGCACTGGAGGG - Intergenic
1197922795 X:131613102-131613124 CTGTAAAAACAGGCAGTGGGGGG - Intergenic