ID: 1014573708

View in Genome Browser
Species Human (GRCh38)
Location 6:123044210-123044232
Sequence CTGGCTACACAGTTCTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014573708_1014573709 -8 Left 1014573708 6:123044210-123044232 CCAGTGAAGAACTGTGTAGCCAG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1014573709 6:123044225-123044247 GTAGCCAGCAAGTCAATGATTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014573708 Original CRISPR CTGGCTACACAGTTCTTCAC TGG (reversed) Intronic
900568880 1:3348698-3348720 CTAGCTGTTCAGTTCTTCACAGG + Intronic
901556397 1:10034613-10034635 CTACCTCCACATTTCTTCACTGG + Intronic
904054773 1:27662840-27662862 GTGGCTCCTCTGTTCTTCACAGG + Intergenic
904557570 1:31375084-31375106 CTGGCCACACAGTCCTTGAGAGG - Intronic
905326171 1:37153422-37153444 CTGCCTACACAATCCTTCAGAGG + Intergenic
905534533 1:38710051-38710073 CTGGTTAAAGAGTTCTTCAATGG + Intergenic
905635316 1:39547186-39547208 CTGGCTAGCCAGTTCCTCAAGGG - Intergenic
907272485 1:53299019-53299041 CTGGCTGCAGAGTTCTGCTCTGG - Intronic
910107705 1:83649290-83649312 CTTGCTACAGACTTCTTCATAGG + Intergenic
910238376 1:85059742-85059764 CTGGTTACACAGCTCCTGACTGG - Intronic
910557903 1:88557021-88557043 CTGTTTCGACAGTTCTTCACAGG + Intergenic
912043787 1:105427279-105427301 CTGGGTACAGAATTCTACACTGG - Intergenic
912557371 1:110525763-110525785 CTGACCACACAGTTCCACACAGG + Intergenic
912756189 1:112326466-112326488 CTGGATGCACAGTTCTGCCCTGG + Intergenic
915639254 1:157209615-157209637 CTGGCTTCAGACTTCTTCTCTGG + Intergenic
915658897 1:157384562-157384584 CTGGCTTCAGATTTCTTCCCTGG + Intergenic
917851589 1:179069184-179069206 GTGGCTAGACAGGTCTTCAGTGG + Intronic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
921187082 1:212679326-212679348 CTGGCTTCAAAGTTACTCACAGG + Intergenic
923747053 1:236711102-236711124 CTGGCTATACAGGCCTTCCCTGG - Intronic
1063995577 10:11615351-11615373 TTGGGTTCACAGTTCTTCATGGG - Intergenic
1064131443 10:12713499-12713521 CACGGTACACAGTTGTTCACTGG + Intronic
1065359560 10:24876865-24876887 ATGGCTACTCAGTCCTCCACTGG + Intronic
1065672420 10:28134908-28134930 CTGGGTACACAATTCTGGACTGG - Intronic
1066266687 10:33782891-33782913 CTGGCTACACACTGCTTCTGAGG + Intergenic
1073105813 10:101031610-101031632 CTGGCTACCCAGTTCTGGAATGG + Intronic
1084346088 11:68549912-68549934 CTGTCTCCACAGCTATTCACAGG - Intronic
1086242796 11:84716208-84716230 CTGGATAGACACTTCTTCAAAGG - Intronic
1087527406 11:99334201-99334223 CTGGCTTCACAATTCATGACAGG + Intronic
1095546797 12:43381484-43381506 CTGGCTGCTCATTTTTTCACTGG - Intronic
1096559780 12:52427765-52427787 TTGGCTACACAGCTCCTAACTGG + Intronic
1098894406 12:76041167-76041189 CTTGCTACACAGTCCCACACAGG + Exonic
1100802224 12:98244312-98244334 CCAGCTACAAAGTCCTTCACTGG - Intergenic
1100858095 12:98776122-98776144 CTGGCTTCACCATTCTGCACAGG - Intronic
1102697970 12:114814958-114814980 CTTGCTACACAGTTTCTCCCCGG - Intergenic
1103125132 12:118415404-118415426 CTGACAACAAAGTTCTCCACAGG - Exonic
1103134766 12:118498003-118498025 CTGGCCACACTCTTCCTCACAGG + Intergenic
1103869458 12:124080956-124080978 CGGTCTGCACAGTTCTTCAGAGG - Intronic
1104058070 12:125245547-125245569 CTAGCTACACAGAACTGCACAGG - Intronic
1104141499 12:125991012-125991034 CTGGTTACAGAGTTCTTGATTGG - Intergenic
1104407332 12:128528861-128528883 CTGAATACACAGCTCTTCAGGGG - Intronic
1106034719 13:26033312-26033334 CTGGCTACTCTCTTCTTCTCAGG - Intergenic
1106370435 13:29127297-29127319 CTGAGTACCCAGTTATTCACTGG + Intronic
1112594198 13:100792863-100792885 CTGGGTACACAGTCCTTTACAGG + Intergenic
1113675971 13:112208264-112208286 GAGGCTTCACAGTTCTTCCCTGG + Intergenic
1117730025 14:58713038-58713060 CTGGATATCCAGATCTTCACTGG + Intergenic
1118596730 14:67441420-67441442 CTGCCCACACAGTGGTTCACTGG - Intergenic
1121985081 14:98497498-98497520 CTGGGTAAAAAGTTCTACACAGG + Intergenic
1122820097 14:104338532-104338554 CTGGCTGCACACTTCGTCCCGGG + Intergenic
1125601057 15:40915984-40916006 CTGGCTGCACACTGCGTCACTGG + Intergenic
1133010284 16:2906705-2906727 CTGGCTGCACTGTTATTTACTGG + Intergenic
1133125208 16:3641883-3641905 CTGGTTCCACAGTTCTCCCCAGG - Intronic
1134618662 16:15671090-15671112 GTGGATACACAGGTATTCACTGG - Intronic
1135824916 16:25718184-25718206 CTGGATTAACAGTTCTTCAAAGG - Intronic
1137249612 16:46732276-46732298 CTGGCTGCACAGTCCTGCTCAGG + Exonic
1138111878 16:54330477-54330499 CTGACTCCAGAGTCCTTCACTGG - Intergenic
1138762932 16:59565763-59565785 CCTGCTTCACAGTTCATCACTGG + Intergenic
1139163063 16:64534725-64534747 CTGGCAGCACAGTTCTTCCCAGG - Intergenic
1142441842 16:90103536-90103558 CTGGCTTGACAGTTGTTCTCAGG + Intergenic
1143614760 17:8043122-8043144 GGGGCTACATGGTTCTTCACGGG + Intronic
1145720656 17:27068835-27068857 CTGGATGGCCAGTTCTTCACAGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147789305 17:43003407-43003429 GAGGCTACACAATTCTTCACAGG - Intergenic
1149489723 17:57075040-57075062 CTGGCCACACATTTCTTCTGTGG - Intergenic
1151584928 17:75003198-75003220 CCGCCTACACAGTTCCTCCCTGG + Exonic
1157385775 18:47259307-47259329 CAGCCAACACAGTCCTTCACAGG - Intergenic
1161884160 19:6980681-6980703 CTGACCACACAGTTCTCCAGTGG - Intergenic
1163471309 19:17498708-17498730 CTGGCTGCACTGTTATTTACTGG + Intronic
925521109 2:4746851-4746873 CTGGCTACACAGGTGGGCACAGG + Intergenic
925783220 2:7403028-7403050 CTGGCCACACAGCTGTTCCCAGG - Intergenic
926508567 2:13745337-13745359 CTGGCTACAGACTTCTTTCCAGG - Intergenic
926966722 2:18423171-18423193 CTGGCTACACAGCTTGGCACGGG - Intergenic
927150421 2:20192366-20192388 CTGGCTACAGAGTTTTTCTCTGG + Intergenic
931113374 2:59137655-59137677 CATCCTACACAGTTTTTCACAGG - Intergenic
932642907 2:73467734-73467756 ATGGCTACACAGGATTTCACTGG - Intronic
934082856 2:88484140-88484162 CAGGTCACACAGTTCATCACTGG + Intergenic
936078526 2:109417115-109417137 CTGCCCACACATTTCTTCAGTGG + Intronic
936879227 2:117230260-117230282 CTGGATACAAAATTCTTGACTGG + Intergenic
937937626 2:127258900-127258922 GTGGCCACACAGTTCTCCTCTGG - Intronic
938997276 2:136693649-136693671 TTGGCTAGACAGTGCCTCACAGG - Intergenic
943151586 2:184120668-184120690 CTGGCAAATCAGTTCTTCATTGG - Intergenic
946316756 2:218920996-218921018 GTGGGTACACAGATGTTCACTGG - Intergenic
948720341 2:239895263-239895285 CAGCCTACTCAGTTCTCCACTGG - Intronic
1172506529 20:35466954-35466976 CTGAACACACAGTTCTTCAAGGG + Exonic
1173013521 20:39204235-39204257 CAGGCTACACAATTCCTCCCAGG + Intergenic
1174140372 20:48408851-48408873 CTTTCTACACACTTCTACACAGG + Intergenic
1175116410 20:56685752-56685774 CTTGCTCCTCAGTTCTCCACTGG + Intergenic
1177657425 21:24036578-24036600 CTGGATACACAATTCTTGGCTGG - Intergenic
1178416963 21:32412332-32412354 CTGGCTCCAAAGTGCGTCACGGG + Intronic
1179471342 21:41612840-41612862 GTGGCTCCACAGTCCATCACAGG + Intergenic
1181464545 22:23103834-23103856 CTGGCTACACAGGTCCTCCAGGG - Intronic
1182429337 22:30290834-30290856 GTGGCTACATAGTGTTTCACAGG - Intronic
950951322 3:17003350-17003372 CTGGCTTCAAATTTCTCCACTGG + Intronic
954885625 3:53870741-53870763 CCAGCCACACAGGTCTTCACAGG + Intronic
956201657 3:66712558-66712580 CTGGCTCCACATTTTTACACAGG - Intergenic
957820218 3:85363104-85363126 CGGGCTACACAGCACTGCACAGG + Intronic
959993154 3:112651283-112651305 ATGGTTACACCATTCTTCACTGG - Intergenic
961326438 3:126112072-126112094 CTGGCTTCTCAGTTCCTCAGCGG - Intronic
962864376 3:139435135-139435157 CTGGCAGCACAGGTCTCCACAGG + Intergenic
963834937 3:150048502-150048524 CTGGGCACACAGCTCTTCTCCGG + Intronic
963979132 3:151516438-151516460 CTGGCTGCAAAATCCTTCACAGG - Intergenic
964627084 3:158770259-158770281 CAGGCTACAAATTTCTTCTCTGG - Intronic
968362107 3:198154503-198154525 CTGGCTTGACAGTTGTTCTCAGG + Intergenic
969045678 4:4334897-4334919 CTGGCTGCACAGTTATTTATTGG + Intergenic
969837331 4:9852578-9852600 CTGGCTACAAAATTCTTGATTGG - Intronic
969878627 4:10155080-10155102 TTGGCTACTCTGTTCTCCACAGG + Intergenic
971660407 4:29407266-29407288 CTGGCTACACAACTATTCACAGG + Intergenic
977734859 4:100401777-100401799 CTAACACCACAGTTCTTCACTGG + Intronic
981827270 4:148957574-148957596 CTGACTGCACTGGTCTTCACTGG - Intergenic
983023483 4:162708718-162708740 TTGGGTATACATTTCTTCACAGG + Intergenic
986275369 5:6270578-6270600 CTGCCAACACCATTCTTCACGGG + Intergenic
990890137 5:60639780-60639802 CTGGCTACACTGTTCCTCATGGG - Intronic
992889248 5:81188825-81188847 CTGGCTGCACAGTTTTTGCCGGG + Intronic
994215466 5:97132508-97132530 CTCCCTACACAGTTCCTCAATGG - Intronic
997703215 5:135920447-135920469 TTGGCTGCATAGTCCTTCACTGG + Intergenic
998103668 5:139455001-139455023 CTGTCTACACAGTACTTATCTGG - Intronic
998527673 5:142857439-142857461 CTGGGTACAAGGTTCTTCTCAGG + Intronic
999044365 5:148451254-148451276 CTAGGTACACCGTTCTGCACAGG - Intronic
999115241 5:149157223-149157245 CAGAGTACACAGTTCTTCAGAGG + Intronic
999476754 5:151907317-151907339 CTGTCTACTCACTTCTTCACTGG + Intronic
1000128577 5:158272285-158272307 CTCGCTATACATTTCTTCAAAGG + Intergenic
1002777734 6:342974-342996 CTGGCTACCCAGCTCTTTGCTGG + Intronic
1003350047 6:5308189-5308211 CTGGCTTCATTGTTCTTCCCGGG - Intronic
1005143843 6:22664825-22664847 CTGCCTACCCAGTACTTCCCAGG - Intergenic
1005276985 6:24229966-24229988 TTGGCCACACAGTCCTTCCCCGG + Intronic
1005571431 6:27149225-27149247 CTGGCTCCAGAGCTCTCCACTGG - Intergenic
1006747768 6:36356850-36356872 CTTGATACACACATCTTCACAGG - Intronic
1007769996 6:44184593-44184615 CACACCACACAGTTCTTCACAGG - Intergenic
1014573708 6:123044210-123044232 CTGGCTACACAGTTCTTCACTGG - Intronic
1016860354 6:148711744-148711766 CTTGCAACACAGCACTTCACTGG + Intergenic
1022475211 7:30705614-30705636 CGGGCTCCACAGCTCTTCTCGGG - Intronic
1022769629 7:33455129-33455151 CTTGGTACACAGTTGTTCCCTGG + Intronic
1024494805 7:50033416-50033438 CTGTCTACATGGTTCTTTACAGG + Intronic
1025298884 7:57800259-57800281 CTGGCTACACCATTGTACACAGG - Intergenic
1031012976 7:116542910-116542932 GTGGCCACAGAGATCTTCACAGG + Intronic
1033266118 7:139888677-139888699 CTGGATACACTCTTCTCCACAGG - Intronic
1033706073 7:143886001-143886023 CTAGCAACAAAGTTCTCCACAGG - Intronic
1033889070 7:145985933-145985955 CTGCCTACCGAGATCTTCACTGG - Intergenic
1034101246 7:148452361-148452383 CAGTCTACACAGCTCTTCAAAGG + Intergenic
1038059067 8:23892231-23892253 CTGGATATAAAGTGCTTCACGGG - Intergenic
1039039788 8:33396126-33396148 CTGGCTAGAGAGTTCTTGCCCGG + Intronic
1039039903 8:33397379-33397401 CTGGCTAGAGAGTTCTTGCCCGG - Intronic
1041745777 8:61207764-61207786 CTGGCTGCACAGTACATCTCGGG + Intronic
1041958061 8:63578692-63578714 GTGGCTGCACAGTTCTTCAAGGG - Intergenic
1042694010 8:71535808-71535830 TTAGCTACACACTTCTTCAAAGG + Exonic
1042860594 8:73309278-73309300 AATGCCACACAGTTCTTCACTGG - Intronic
1044727070 8:95202627-95202649 CTGGCTACTAAGTGCCTCACAGG + Intergenic
1046033734 8:108816020-108816042 CTGGATACAAAATTCTTGACTGG + Intergenic
1047227156 8:122966424-122966446 CTGGATACAAAATTCTTGACTGG + Intronic
1048793889 8:138130539-138130561 CGGGCTACACAGTCTTTCAAAGG + Exonic
1051093016 9:13432411-13432433 ATGGATACACAGTACTTCACAGG - Intergenic
1056963476 9:91146904-91146926 GGGGCTGCACGGTTCTTCACCGG - Intergenic
1057698022 9:97341195-97341217 CTGGCTGCACAGTTATTTATTGG - Intronic
1057724819 9:97561041-97561063 CTGGCTTCACAGGCCTTCCCTGG - Intronic
1058774930 9:108273634-108273656 ATGGCCACACAGTTTTCCACAGG + Intergenic
1060640973 9:125238682-125238704 CTGGTTAAAGAGTTCTTCAATGG - Exonic
1060787260 9:126460542-126460564 CTGGCTCCACATCTCTACACAGG - Intronic
1061495304 9:130970365-130970387 TTCCCTCCACAGTTCTTCACAGG - Intergenic
1061787861 9:133041593-133041615 CTGGCTGCACTGTTATTTACTGG - Intronic
1062746794 9:138218165-138218187 CTGGCTTGACAGTTGTTCTCAGG + Intergenic
1190449101 X:50559442-50559464 CTGGATACAAAGTTCTTGGCTGG - Intergenic
1193649330 X:84110326-84110348 CTGGCTCCCCAGTTCATCATTGG + Intronic
1196828566 X:119759107-119759129 CCGGCTACTCGGTTCTGCACTGG + Exonic
1197257652 X:124281084-124281106 CTCGTTACAGATTTCTTCACTGG - Intronic