ID: 1014574766

View in Genome Browser
Species Human (GRCh38)
Location 6:123056633-123056655
Sequence ATTGTATCCTGAGAAACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014574763_1014574766 9 Left 1014574763 6:123056601-123056623 CCTTGGAAGTCACCAAATCTGGT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1014574766 6:123056633-123056655 ATTGTATCCTGAGAAACCAAAGG No data
1014574765_1014574766 -3 Left 1014574765 6:123056613-123056635 CCAAATCTGGTGGTTTTCAAATT 0: 1
1: 0
2: 7
3: 54
4: 347
Right 1014574766 6:123056633-123056655 ATTGTATCCTGAGAAACCAAAGG No data
1014574761_1014574766 10 Left 1014574761 6:123056600-123056622 CCCTTGGAAGTCACCAAATCTGG 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1014574766 6:123056633-123056655 ATTGTATCCTGAGAAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014574766 Original CRISPR ATTGTATCCTGAGAAACCAA AGG Intronic
No off target data available for this crispr