ID: 1014578997

View in Genome Browser
Species Human (GRCh38)
Location 6:123111061-123111083
Sequence GTAGAATTACTAGAAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014578995_1014578997 -10 Left 1014578995 6:123111048-123111070 CCTCAAGTGGAGAGTAGAATTAC No data
Right 1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014578997 Original CRISPR GTAGAATTACTAGAAAAGAA GGG Intergenic
No off target data available for this crispr