ID: 1014583908

View in Genome Browser
Species Human (GRCh38)
Location 6:123174277-123174299
Sequence TTAAATTTCTAAACGTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014583908_1014583911 3 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583911 6:123174303-123174325 TTAAATAATCTTTGTCAAAGGGG No data
1014583908_1014583910 2 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583910 6:123174302-123174324 TTTAAATAATCTTTGTCAAAGGG No data
1014583908_1014583913 14 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583913 6:123174314-123174336 TTGTCAAAGGGGAAGTTTACGGG No data
1014583908_1014583914 15 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583914 6:123174315-123174337 TGTCAAAGGGGAAGTTTACGGGG No data
1014583908_1014583912 13 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583912 6:123174313-123174335 TTTGTCAAAGGGGAAGTTTACGG No data
1014583908_1014583909 1 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583909 6:123174301-123174323 TTTTAAATAATCTTTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014583908 Original CRISPR TTAAATTTCTAAACGTTTAG TGG (reversed) Intergenic
No off target data available for this crispr