ID: 1014583913

View in Genome Browser
Species Human (GRCh38)
Location 6:123174314-123174336
Sequence TTGTCAAAGGGGAAGTTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014583908_1014583913 14 Left 1014583908 6:123174277-123174299 CCACTAAACGTTTAGAAATTTAA No data
Right 1014583913 6:123174314-123174336 TTGTCAAAGGGGAAGTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014583913 Original CRISPR TTGTCAAAGGGGAAGTTTAC GGG Intergenic
No off target data available for this crispr