ID: 1014586330

View in Genome Browser
Species Human (GRCh38)
Location 6:123202230-123202252
Sequence CCACCACGGTGGGGGCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014586330_1014586346 8 Left 1014586330 6:123202230-123202252 CCCCCCCGCCCCCACCGTGGTGG No data
Right 1014586346 6:123202261-123202283 GCAGCCCGAGCCTCCCCAACGGG No data
1014586330_1014586353 28 Left 1014586330 6:123202230-123202252 CCCCCCCGCCCCCACCGTGGTGG No data
Right 1014586353 6:123202281-123202303 GGGCGCCGCACCCTGCTCCGCGG No data
1014586330_1014586345 7 Left 1014586330 6:123202230-123202252 CCCCCCCGCCCCCACCGTGGTGG No data
Right 1014586345 6:123202260-123202282 CGCAGCCCGAGCCTCCCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014586330 Original CRISPR CCACCACGGTGGGGGCGGGG GGG (reversed) Intergenic
No off target data available for this crispr