ID: 1014593720

View in Genome Browser
Species Human (GRCh38)
Location 6:123306284-123306306
Sequence CCCAAACATTTCCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014593717_1014593720 -6 Left 1014593717 6:123306267-123306289 CCTAAGTCTCTGATGACCCCAAA 0: 1
1: 0
2: 0
3: 8
4: 236
Right 1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG 0: 1
1: 0
2: 2
3: 15
4: 204
1014593716_1014593720 15 Left 1014593716 6:123306246-123306268 CCATTTGTTACTTAAATGTGGCC 0: 1
1: 0
2: 6
3: 19
4: 251
Right 1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG 0: 1
1: 0
2: 2
3: 15
4: 204
1014593715_1014593720 16 Left 1014593715 6:123306245-123306267 CCCATTTGTTACTTAAATGTGGC 0: 1
1: 0
2: 4
3: 29
4: 177
Right 1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG 0: 1
1: 0
2: 2
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014593720 Original CRISPR CCCAAACATTTCCCCAGACA TGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
904989286 1:34578597-34578619 CCCAAGGTTTTCCCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907339642 1:53725783-53725805 CCCTAACAATTGGCCAGACAGGG + Intronic
909280945 1:73752875-73752897 CACAAACATTTGCCCCCACAAGG - Intergenic
911250514 1:95571384-95571406 ACCAAACATTTGCTGAGACAGGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912728456 1:112079711-112079733 CCCAAGCCTGTCCCCAGCCATGG - Intergenic
912775330 1:112503079-112503101 CCCAGACATGGCCCCAGAAAGGG + Intronic
912902986 1:113672745-113672767 AACAAACATTTCCCCAGATGGGG + Intronic
915075313 1:153303788-153303810 CCCAAACATGACTCCAAACATGG + Intronic
915331608 1:155116320-155116342 GCCCAACACCTCCCCAGACATGG + Intergenic
918028801 1:180782453-180782475 TGCAAGCATTTCCCCAAACATGG + Intronic
924775837 1:247114047-247114069 CCCCAACCTTGACCCAGACAGGG - Intergenic
1062984196 10:1752312-1752334 CCCCAACATTTCTGCATACATGG - Intergenic
1064639694 10:17403113-17403135 CCCACAGATTACCCCAAACAGGG + Intronic
1065694591 10:28368415-28368437 CCCAAAGAGCTCCCCAGACCTGG + Intergenic
1066467176 10:35662856-35662878 GGCAAACATTTCCTCAGAGATGG - Intergenic
1066623837 10:37385670-37385692 CCCAAGCATTTCACCAGCCCTGG - Intergenic
1071435395 10:85644230-85644252 CCCATACATTTCTCCAGGAATGG + Intronic
1072888990 10:99304698-99304720 CCCAAATATTTGCTCAGAAATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074553334 10:114465697-114465719 CCCCAGCATTTCCACAGACCTGG - Exonic
1075180298 10:120204945-120204967 TGCAATCATTTCCCCAGACCTGG - Intergenic
1076913439 10:133404042-133404064 AACAGACATTTCCCCAGAGAGGG - Intronic
1077265712 11:1648501-1648523 CCCAAACTGTCCCCCAGCCAGGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1084887725 11:72221948-72221970 CCAAAACAATTCCACAGACATGG - Intronic
1085444610 11:76592057-76592079 CCCAAACCTGGCCCAAGACAAGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087051708 11:93892337-93892359 ACCAAACATTTGGCCAGGCACGG - Intergenic
1089226795 11:116930931-116930953 TCCAAACATGTACCCAGACAGGG + Intronic
1089391371 11:118104285-118104307 CTCAGACATTTCCCCAGGCTGGG + Intronic
1089538200 11:119173552-119173574 CCCAACCTTTGCCCTAGACACGG + Exonic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091193561 11:133714069-133714091 CCCAAACATTTTCCCTGAGTCGG + Intergenic
1091297341 11:134483188-134483210 TCCAGACCTTTCCCCAGCCAGGG - Intergenic
1093043646 12:14415458-14415480 TACCAACAATTCCCCAGACAAGG - Intronic
1093551999 12:20423826-20423848 CCCAAACATATCCCAAGGTAAGG + Intronic
1095096115 12:38150193-38150215 CCCAATCTAATCCCCAGACAAGG - Intergenic
1095783986 12:46090321-46090343 CTCAAACATATCCCCACTCAAGG - Intergenic
1096501054 12:52064072-52064094 CCCAGACATTTTCCCCGTCAGGG + Intergenic
1097015978 12:55987519-55987541 CCCATTCTTTTCCCCAGAAATGG + Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1103234201 12:119358576-119358598 CTCAAACATCCTCCCAGACATGG + Intronic
1103650795 12:122430742-122430764 CCAAAACATTTCCAAAGATAGGG + Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1110283878 13:73727081-73727103 GTCAAACATTTCTCCAGAGAAGG - Intronic
1113392044 13:109907329-109907351 CCCACACACCTCCCCAGACAAGG - Intergenic
1114577210 14:23725963-23725985 CCCAAACAGGGCCCCACACAGGG + Intergenic
1115963713 14:38863840-38863862 CGCAGACATTTTCCCAGACCTGG - Intergenic
1118346666 14:64946121-64946143 CCCATACCTTTTCCCAGTCATGG + Exonic
1118562878 14:67106333-67106355 TCCATACCTTTCCCCAGACTTGG + Intronic
1118877569 14:69797812-69797834 AACAAACATTTCCCCAGAACAGG - Intergenic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1124630489 15:31334071-31334093 CCCCAACATCTCTCCAGTCAAGG - Intronic
1124810328 15:32930541-32930563 TCCAAACATTTCTCCAAAAAAGG - Intronic
1125202414 15:37111498-37111520 CCCAGTAATTTCCCCAGACTGGG - Intergenic
1125301460 15:38257946-38257968 ACCAATCATTTCCCCAAACTGGG - Intronic
1125697152 15:41648657-41648679 TCCAAACATTTTCTCAGAGAAGG - Intronic
1127810657 15:62562374-62562396 CCCAAACACATCCCCAGTGAAGG - Intronic
1129230879 15:74196654-74196676 CTCAAACACTGCCCCAGCCAGGG + Intronic
1130823372 15:87518254-87518276 CCAGTGCATTTCCCCAGACAGGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133276495 16:4641234-4641256 CCCTAACACTTCCCCAGGCCTGG + Intronic
1133494262 16:6301597-6301619 CCCACACACCTCCTCAGACACGG - Intronic
1134855987 16:17519582-17519604 CTCAAATAAATCCCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135756860 16:25105873-25105895 CCTATACCTTTCCCCAGAAATGG - Intergenic
1138277995 16:55750201-55750223 ACCAGACAATTCCCCAGCCATGG - Intergenic
1138283989 16:55794047-55794069 ACCAGACAATTCCCCAGCCATGG - Intergenic
1138285013 16:55802940-55802962 ACCAGACAATTCCCCAGCCATGG + Exonic
1140751457 16:78028090-78028112 CCTAAAATTTTCCCCAGACAAGG + Exonic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142148105 16:88500949-88500971 CCCTGACATATCCCCAGCCAAGG - Intronic
1143075447 17:4338945-4338967 CCCAGACATTTCCCCTGAGCAGG - Intronic
1146953753 17:36923888-36923910 CACTAACAGTTCCCCAGGCAGGG - Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148402577 17:47379878-47379900 TCCAAAAAATTCCCCAGATAAGG + Intronic
1149030344 17:52075702-52075724 CCAAAATATTCCCCCAGAAACGG + Intronic
1149545409 17:57499905-57499927 CACAAATGTTTCCACAGACAAGG + Intronic
1150295485 17:64005173-64005195 CTCAAACATCTCCCATGACACGG - Exonic
1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG + Exonic
1153421096 18:4906213-4906235 CCCATACATTTCCCCAAACACGG + Intergenic
1153863223 18:9234762-9234784 CACAAGCATTGCACCAGACAGGG - Intronic
1157025092 18:43832971-43832993 CCAGAACACTTCTCCAGACAAGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159618814 18:70613531-70613553 CTCAAACAGTTCCACAGAAATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161025560 19:2035113-2035135 CCCAAACTTCGCCCCAGACGAGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161732251 19:5968446-5968468 GCCAACCACTTCCCCAAACACGG - Intronic
1162224515 19:9209096-9209118 TCCAAACATTTCCCATCACAAGG - Intergenic
1162927837 19:13938897-13938919 GCCAACCATTACCCCAGAAAGGG - Intronic
1163296763 19:16417771-16417793 CCCAGGTATTTCCCCAGGCAGGG - Intronic
1164458406 19:28427613-28427635 CACAAACATTCCCACACACACGG + Intergenic
1165946100 19:39443465-39443487 CACAGTCATTTCCCCAGCCATGG - Intronic
1167663088 19:50807863-50807885 CCCAAAGATGGCCCCAGAGAGGG + Intergenic
1168426834 19:56245839-56245861 CACAAACACATCTCCAGACATGG - Intronic
925995595 2:9290150-9290172 CCCAAAGCTTTCCCTGGACAAGG - Intronic
926514132 2:13819942-13819964 CACAAACATTTCCTCTGACTGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930502264 2:52236131-52236153 CTCAAACTTTTCTCCTGACAAGG - Intergenic
931002744 2:57806609-57806631 TCCAAATATTCCCCAAGACATGG + Intergenic
931567739 2:63632834-63632856 TCCATACATATCCCCAGACTTGG - Intronic
935527167 2:104184272-104184294 ACTAAACATTTCCCCAGAATAGG - Intergenic
935856826 2:107283470-107283492 GCAAAACATTCCCCAAGACAGGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938204264 2:129403875-129403897 CCTAACCACTTCCCCAGACAAGG - Intergenic
947545808 2:231009404-231009426 CCCACACATTTCCCCGGGGATGG - Intronic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
948118418 2:235511052-235511074 ACCGAAAATTGCCCCAGACATGG - Intronic
1170140462 20:13121118-13121140 CCCAAACTTTTCCCCAGGCAAGG + Intronic
1171388998 20:24789330-24789352 GGTTAACATTTCCCCAGACATGG + Intergenic
1174357060 20:50005626-50005648 CCCAAACATTTCCCCACCCCAGG - Intergenic
1176703813 21:10093622-10093644 CCCAAACATATGCCAAGCCAGGG - Intergenic
1178624869 21:34206077-34206099 CCCAAACAATCCCCTAGAAATGG + Intergenic
1179098651 21:38337291-38337313 CCCCAACAATTCCACAGACTGGG + Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182030276 22:27153959-27153981 CCAGAACATTTCCCCAGCAATGG + Intergenic
1182953946 22:34403257-34403279 CCTAAACATGTGCCAAGACACGG - Intergenic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
951619788 3:24588305-24588327 CCAAAACATATCCTGAGACAAGG - Intergenic
956014977 3:64872990-64873012 TCCAATCAATTCCCCAGATAAGG + Intergenic
956723271 3:72136763-72136785 GCCCAACATTTCTCCAGATATGG + Intergenic
957733452 3:84175304-84175326 CCTAAATATTTCCCTAGACTGGG + Intergenic
958926684 3:100165639-100165661 CTCATCCATTTCCCCAGATATGG + Intronic
959321832 3:104886549-104886571 CCATAACATGTCCCCAGTCAAGG - Intergenic
959563203 3:107806219-107806241 GGCAAATATTTTCCCAGACAGGG + Intronic
961453915 3:127015075-127015097 CACAGACAGTTCCCCAGACTAGG - Intronic
964003365 3:151803707-151803729 CCCCAACATTTCAGCAAACAGGG - Intergenic
964477165 3:157107598-157107620 CCCAAAAGTTGCCCCAGAGAAGG + Intergenic
966848419 3:184148315-184148337 CCCTACCATTTCTCCAGAGACGG - Intronic
967896073 3:194397059-194397081 CCCAAACACGTCGCCAGGCAGGG + Exonic
968515754 4:1015003-1015025 AACCAACATTTCCCCTGACAGGG - Intronic
969135748 4:5027382-5027404 CCCAAACATTGCCCCAGGCCTGG + Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
972963576 4:44483576-44483598 CAGAAACATTTCCCTAGACCCGG - Intergenic
973893922 4:55394027-55394049 CCTAAAGGTTTCCCCATACATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977248685 4:94664209-94664231 GCCAAATATTTCCTCAGACTTGG - Exonic
980291542 4:130852124-130852146 CCCAACCATTGCCCCAGCCGTGG + Intergenic
980376029 4:131949973-131949995 CCCAAACATATGCCAAGCCAGGG - Intergenic
980971499 4:139571664-139571686 CCCACACAACTCCCCAGCCAGGG - Intronic
981516599 4:145617014-145617036 CCAAAACATTTACCAAGACGAGG + Intergenic
983189812 4:164743076-164743098 CCAAAACATTTAGCCAGACATGG + Intergenic
984262536 4:177459047-177459069 CCCTTACATTTTCCCATACAGGG - Intergenic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984538512 4:181007046-181007068 CCCAGACCTCTCCCCTGACAGGG + Intergenic
985843360 5:2326201-2326223 CCCAAACACAGTCCCAGACATGG + Intergenic
987049703 5:14139223-14139245 TCCACACCATTCCCCAGACATGG + Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
992838909 5:80668190-80668212 CCCATACAAATCCCCAGACTCGG - Intronic
997351526 5:133234592-133234614 ACCAAACATTTCCCAGGATATGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
999178898 5:149654687-149654709 CCCCAACCTTTTCCCAGACTTGG - Intergenic
1000088352 5:157908582-157908604 CCCAATCCTTTCCCCAGGCTGGG - Intergenic
1000561565 5:162795883-162795905 TCCAAACAGTTCCCAAAACATGG + Intergenic
1002551416 5:179995580-179995602 CCCATGCATTTTCCCAGACCTGG - Intronic
1004179828 6:13371667-13371689 CCCAAACATTTCCCAAGTGGTGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009947311 6:70354732-70354754 CCCACAAATCTCCCAAGACATGG - Intergenic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1016555469 6:145331335-145331357 GCCAAAAAGTTTCCCAGACAAGG - Intergenic
1019496078 7:1341258-1341280 CCCAAAGAAGTCCCCAGCCATGG - Intergenic
1022697573 7:32724785-32724807 ACCAAACAATTACCAAGACAGGG + Intergenic
1027659464 7:80971624-80971646 CACAAACATTTCCCCAGCATTGG + Intergenic
1027827461 7:83134751-83134773 CCCAAAGAGTTTCCCAGTCACGG + Exonic
1029586493 7:101475382-101475404 CCCACACTTTTCCCCTGACACGG - Intronic
1032359601 7:131243061-131243083 GCCAAACTTTTCCACAGCCATGG + Intronic
1033184125 7:139210159-139210181 CACACACATATCCCCACACATGG - Intergenic
1034978567 7:155461594-155461616 CACCACCCTTTCCCCAGACATGG - Intronic
1035137675 7:156720397-156720419 CACAGACATTTTCTCAGACAGGG + Intronic
1035345931 7:158198207-158198229 CACAAACAAGTCCCCAGGCATGG - Intronic
1036795024 8:11749543-11749565 CCCAAACTCTTCCCTAGCCACGG - Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1039273335 8:35907124-35907146 CCCAAACATTCCTCCAGCCCTGG + Intergenic
1044751054 8:95415803-95415825 CCCACACAATTGCCAAGACATGG - Intergenic
1046707302 8:117469220-117469242 CAGAAACATATCCCCAGGCAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1049289850 8:141796021-141796043 CCCAAACAGTTCCAGAGGCAGGG + Intergenic
1049588019 8:143440867-143440889 CCCGGGCATCTCCCCAGACAGGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1054321818 9:63676937-63676959 CCCAAACATATGCCAAGCCAGGG - Intergenic
1056206762 9:84326851-84326873 CCAAAAAATTTAGCCAGACATGG + Intronic
1057731954 9:97617366-97617388 CACAAACATTTCCCTATACCAGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1061857380 9:133449693-133449715 CCCCTTCATTTCCCCAGACTAGG - Intronic
1202788850 9_KI270719v1_random:63717-63739 CCCAAACATATGCCAAGCCAGGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186227315 X:7413669-7413691 CCCACACTTTATCCCAGACATGG - Intergenic
1186357088 X:8800548-8800570 CCCTGACATTCCCCCAGAGATGG - Intronic
1187270766 X:17777160-17777182 CCCATCCATTTCCCCAGGAATGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190139985 X:47834536-47834558 AACAAACATTTGCCCAGACCAGG + Intergenic
1190552962 X:51603628-51603650 CCCATCCATTTCCTCAGACATGG + Intergenic
1192017533 X:67347679-67347701 CCTAAACATTGCACCAGGCATGG - Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1195727478 X:107933360-107933382 CCAAAATATTTCCCCTGGCAGGG - Intergenic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196505264 X:116434784-116434806 CCCAAACATATCACAAGGCAAGG - Intergenic
1199204012 X:145125743-145125765 CCCAAATTATTTCCCAGACAGGG - Intergenic
1199875217 X:151923049-151923071 CCCTCACATTTCTCCAGGCAGGG - Intronic
1200984787 Y:9293377-9293399 ACTAAACATTTCCCCATTCATGG - Intergenic
1202125653 Y:21566810-21566832 ACTAAACATTTCCCCATTCATGG + Intergenic
1202153355 Y:21862582-21862604 ACTAAACATTTCCCCATTCATGG - Intergenic
1202339987 Y:23853748-23853770 TCCAAACCTTTCCCAAGCCAGGG + Intergenic
1202342830 Y:23887815-23887837 CCCAAACCTGGCCCCTGACATGG + Intergenic
1202527938 Y:25782270-25782292 CCCAAACCTGGCCCCTGACATGG - Intergenic
1202530779 Y:25816334-25816356 TCCAAACCTTTCCCAAGCCAGGG - Intergenic